SubtiBank SubtiBank
yvaK [2019-07-10 11:42:03]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yvaK [2019-07-10 11:42:03]

general stress protein, carboxylesterase
locus
BSU33620
pI
4.99
mw
28.26 kDa
protein length
248 aa Sequence Blast
gene length
747 bp Sequence Blast
function
unknown
product
unknown
essential
no
ec
3.1.1.1
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    3,454,221 → 3,454,967

    The protein

    Catalyzed reaction/ biological activity

  • A carboxylic ester + H2O = an alcohol + a carboxylate (according to Swiss-Prot)
  • Protein family

  • lipase/esterase LIP3/bchO family (according to Swiss-Prot)
  • Structure

  • [PDB|1TQH] (Geobacillus stearothermophilus)
  • Expression and Regulation

    Operons

    genes
    [gene|D8851F453E5EF18D36F25834A8CB9C61EAF15E44|secG]-[gene|C0B6520E74CE9F7EE3DEC8C0D83E0770F241C4E8|yvaK]-[gene|0472A4346ADA1DC41C9D00E8F3222A0EBB76DFA8|rnr]-[gene|D19519B5A776D6E8EC2BFE7A7D67469CA0A6459A|smpB]-[gene|5C12BB19B975F7FEBCFA119DAC66338C20FCECFA|ssrA]
    description
    [Pubmed|17369301]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • ''[protein|search|yvaK]'': induced by stress ([protein|search|SigB]) [Pubmed|11544224]
  • view in new tab

    genes
    [gene|C0B6520E74CE9F7EE3DEC8C0D83E0770F241C4E8|yvaK]-[gene|0472A4346ADA1DC41C9D00E8F3222A0EBB76DFA8|rnr]-[gene|D19519B5A776D6E8EC2BFE7A7D67469CA0A6459A|smpB]-[gene|5C12BB19B975F7FEBCFA119DAC66338C20FCECFA|ssrA]
    description
    [Pubmed|17369301]

    regulation

  • ''[protein|search|yvaK]'': induced by stress ([protein|search|SigB]) [Pubmed|11544224]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B606 (yvaK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1605 NBRP B. subtilis, Japan]
  • BKE33620 (Δ[gene|C0B6520E74CE9F7EE3DEC8C0D83E0770F241C4E8|yvaK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTCATGTCTCCCTTTC, downstream forward: _UP4_TGGTAATCAACAGGAGGTCG
  • BKK33620 (Δ[gene|C0B6520E74CE9F7EE3DEC8C0D83E0770F241C4E8|yvaK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTCATGTCTCCCTTTC, downstream forward: _UP4_TGGTAATCAACAGGAGGTCG
  • References

  • 11544224,17369301,23812333