SubtiBank SubtiBank
chrS
The papers of the month are back! Check them out! Link here

chrS

transcriptional repressor (Lrp family) of the chrS-ywrB-ywrA operon
locus
BSU36110
pI
5.84
mw
17.98 kDa
protein length
158 aa Sequence Blast
gene length
474 bp Sequence Blast
function
regulation of chromate export
product
transcriptional repressor (Lrp family)
essential
no
synonyms
ywrC

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.11|Resistance against toxic metals]
  • Gene

    Coordinates
    3,720,925 → 3,721,401

    The protein

    Protein family

  • [SW|Lrp family]
  • Expression and Regulation

    Operons

    genes
    [gene|C0BEEAD315077FE3D0D061D1D447D03E6CB48D6A|chrS]-[gene|E63704C51B53F05BAD9B35D3B6874DB9231B6D24|ywrB]-[gene|70CC5C9BCC676AB89C0BF80686BD98BA08FAE648|ywrA]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|23989926], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|C0BEEAD315077FE3D0D061D1D447D03E6CB48D6A|ChrS]: repression, [Pubmed|23989926], in [regulon|C0BEEAD315077FE3D0D061D1D447D03E6CB48D6A|ChrS regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A533 (ywrC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/533 NBRP B. subtilis, Japan]
  • BKE36110 (Δ[gene|C0BEEAD315077FE3D0D061D1D447D03E6CB48D6A|chrS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTGCTCCACCTGCTTTC, downstream forward: _UP4_ATGAAGCTGTAAAGGAGAGA
  • BKK36110 (Δ[gene|C0BEEAD315077FE3D0D061D1D447D03E6CB48D6A|chrS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTGCTCCACCTGCTTTC, downstream forward: _UP4_ATGAAGCTGTAAAGGAGAGA