SubtiBank SubtiBank
chrS
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

chrS

transcriptional repressor ([SW|Lrp family]) of the [gene|C0BEEAD315077FE3D0D061D1D447D03E6CB48D6A|chrS]-[gene|E63704C51B53F05BAD9B35D3B6874DB9231B6D24|ywrB]-[gene|70CC5C9BCC676AB89C0BF80686BD98BA08FAE648|ywrA] operon
locus
BSU_36110
pI
5.84
mw
17.98 kDa
protein length
158 aa Sequence Blast
gene length
477 bp Sequence Blast
function
regulation of chromate export
product
transcriptional repressor ([SW|Lrp family])
essential
no
synonyms
ywrC

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.11|Resistance against toxic metals]
  • Gene

    Coordinates
    3,720,925 → 3,721,401

    The protein

    Protein family

  • [SW|Lrp family]
  • Structure

  • [PDB|1RI7] (from Pyrococcus sp., 31% identity) [pubmed|14976242]
  • Expression and Regulation

    Operons

    genes
    [gene|C0BEEAD315077FE3D0D061D1D447D03E6CB48D6A|chrS]-[gene|E63704C51B53F05BAD9B35D3B6874DB9231B6D24|ywrB]-[gene|70CC5C9BCC676AB89C0BF80686BD98BA08FAE648|ywrA]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|23989926], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|C0BEEAD315077FE3D0D061D1D447D03E6CB48D6A|ChrS]: repression, [Pubmed|23989926], in [regulon|C0BEEAD315077FE3D0D061D1D447D03E6CB48D6A|ChrS regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A533 (ywrC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/533 NBRP B. subtilis, Japan]
  • BKE36110 (Δ[gene|C0BEEAD315077FE3D0D061D1D447D03E6CB48D6A|chrS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTGCTCCACCTGCTTTC, downstream forward: _UP4_ATGAAGCTGTAAAGGAGAGA
  • BKK36110 (Δ[gene|C0BEEAD315077FE3D0D061D1D447D03E6CB48D6A|chrS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTGCTCCACCTGCTTTC, downstream forward: _UP4_ATGAAGCTGTAAAGGAGAGA
  • References

    Research papers

  • 14976242