SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


transcriptional repressor ([SW|Lrp family]) of the [gene|C0BEEAD315077FE3D0D061D1D447D03E6CB48D6A|chrS]-[gene|E63704C51B53F05BAD9B35D3B6874DB9231B6D24|ywrB]-[gene|70CC5C9BCC676AB89C0BF80686BD98BA08FAE648|ywrA] operon
17.98 kDa
protein length
158 aa Sequence Blast
gene length
477 bp Sequence Blast
regulation of chromate export
transcriptional repressor ([SW|Lrp family])

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.11|Resistance against toxic metals]
  • Gene

    3,720,925 → 3,721,401

    The protein

    Protein family

  • [SW|Lrp family]
  • [SW|Domains]

  • [SW|HTH asnC-type domain] (aa 12-73) (according to UniProt)
  • Structure

  • [PDB|1RI7] (from Pyrococcus sp., 31% identity) [pubmed|14976242]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|23989926], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|C0BEEAD315077FE3D0D061D1D447D03E6CB48D6A|ChrS]: repression, [Pubmed|23989926], in [regulon|C0BEEAD315077FE3D0D061D1D447D03E6CB48D6A|ChrS regulon]
  • view in new tab

    Biological materials


  • MGNA-A533 (ywrC::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE36110 (Δ[gene|C0BEEAD315077FE3D0D061D1D447D03E6CB48D6A|chrS]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTGCTCCACCTGCTTTC, downstream forward: _UP4_ATGAAGCTGTAAAGGAGAGA
  • BKK36110 (Δ[gene|C0BEEAD315077FE3D0D061D1D447D03E6CB48D6A|chrS]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTGCTCCACCTGCTTTC, downstream forward: _UP4_ATGAAGCTGTAAAGGAGAGA
  • References

    Research papers

  • 14976242