SubtiBank SubtiBank
ykuT
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ykuT

mechanosensitive channel, similar to MscS, general stress protein
locus
BSU_14210
pI
5.65
mw
29.88 kDa
protein length
267 aa Sequence Blast
gene length
804 bp Sequence Blast
function
resistance to osmotic downshock
product
anion-selective mechanosensitive channel of small conductance
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.7|Coping with hypo-osmotic stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,491,221 → 1,492,024

    The protein

    Protein family

  • [SW|MscS (TC 1.A.23) family] (according to UniProt)
  • Structure

  • [PDB|3T9N] (from Thermoanaerobacter tengcongensis, 40% identity) [pubmed|23074248]
  • [SW|Localization]

  • cell membrane [Pubmed|19252899]
  • Expression and Regulation

    Operons

    genes
    [gene|C0C65835A0E2680F52D391BF4EAB7F463FBB1DD3|ykuT]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B342 (ykuT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1341 NBRP B. subtilis, Japan]
  • 1A960 ( ''ykuT''::''cat''), [Pubmed|18310427], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A960&Search=1A960 BGSC]
  • BKE14210 (Δ[gene|C0C65835A0E2680F52D391BF4EAB7F463FBB1DD3|ykuT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14210 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTGAGCTCCTTTTCTA, downstream forward: _UP4_TAAATAAAAGAACCGAAGCT
  • BKK14210 (Δ[gene|C0C65835A0E2680F52D391BF4EAB7F463FBB1DD3|ykuT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14210 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTGAGCTCCTTTTCTA, downstream forward: _UP4_TAAATAAAAGAACCGAAGCT
  • Labs working on this gene/protein

  • [SW|Erhard Bremer], University of Marburg, Germany [http://www.uni-marburg.de/fb17/fachgebiete/mikrobio/molmibi homepage]
  • References

    Reviews

  • 12626684,22685280,22404681,24607989,17505523
  • Original Publications

  • 17665170,18310427,19252899,11544224,23074248