SubtiBank SubtiBank
yyaF
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yyaF

GTP-binding protein/ GTPase
locus
BSU_40920
pI
4.66
mw
39.91 kDa
protein length
366 aa Sequence Blast
gene length
1101 bp Sequence Blast
function
unknown
product
GTP-binding protein/ GTPase
essential
no
synonyms
engD

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.3|GTP-binding proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    4,199,843 → 4,200,943

    The protein

    Catalyzed reaction/ biological activity

  • Binds and hydrolyzes GTP and readily exchanges GDP for GTP
  • Protein family

  • TRAFAC class OBG-HflX-like GTPase superfamily (with [protein|84E7D672DB40B114DC4D96A4D8834958B47401A7|Obg] and [protein|9F6B78C1932FB56F7F71430DB16BC862A312407B|YnbA], according to UniProt)
  • Paralogous protein(s)

  • [protein|CB68B3393CA7862C45C624AF7B1ADD188243A01F|Era], [protein|DF1A043F3D9817D9479B8C707F4ACEEF2BF2862C|YsxC], [protein|54CD247926F7FABE4ACE85EB7021B62500B47260|RbgA], [protein|66A6EC4F6CB91EE741BB9D7646913FF3EE602BD7|ThdF], [protein|84E7D672DB40B114DC4D96A4D8834958B47401A7|Obg], [protein|959C0ED7B9DA50F0EADCF1565405B878D36DA206|YqeH], [protein|9F6B78C1932FB56F7F71430DB16BC862A312407B|YnbA], [protein|B2270316642C66BC2DA86EBDCD1BF6A33CC6A1DC|YphC]
  • [SW|Domains]

  • OBG-typeG domain (aa 3-259) (according to UniProt)
  • [SW|TGS domain] (aa 281-364) (according to UniProt)
  • Structure

  • [PDB|1JAL] (from Haemophilus influenzae, 58% identity) [pubmed|12837776]
  • Expression and Regulation

    Operons

    genes
    [gene|BD162A17E5F3F9AB49E478CE72D0FE92D82E6673|yyzM]-[gene|FEE1952DFA3D6A5E2DC108B3B203B526642E2C68|yyaE]-[gene|C0F5FAD6DF89DA9E0FFC8F888D7CED6AA42D9C73|yyaF]-[gene|9D25B8F4579C41E77AE9CDD18CAD6DA37F3DD0A2|rpsF]-[gene|8DE39680CA7663803A107066FBE9AFFCC77DB72A|ssbA]-[gene|C0B926F1134A7A3FEEC886F9AF67F694C8E0C089|rpsR]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|C0F5FAD6DF89DA9E0FFC8F888D7CED6AA42D9C73|yyaF]-[gene|9D25B8F4579C41E77AE9CDD18CAD6DA37F3DD0A2|rpsF]-[gene|8DE39680CA7663803A107066FBE9AFFCC77DB72A|ssbA]-[gene|C0B926F1134A7A3FEEC886F9AF67F694C8E0C089|rpsR]
    description
    [Pubmed|14762004]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|24310371], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • regulation

  • [protein|search|ComK]: transcription activation [Pubmed|11948146]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B869 (yyaF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1868 NBRP B. subtilis, Japan]
  • BKE40920 (Δ[gene|C0F5FAD6DF89DA9E0FFC8F888D7CED6AA42D9C73|yyaF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTTTCATCTCCTCTAT, downstream forward: _UP4_TAGGATGCAGTTGTAAAGGG
  • BKK40920 (Δ[gene|C0F5FAD6DF89DA9E0FFC8F888D7CED6AA42D9C73|yyaF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTTTCATCTCCTCTAT, downstream forward: _UP4_TAGGATGCAGTTGTAAAGGG
  • Expression vectors

  • for expression/ purification from ''B. subtilis'' with N-terminal Strep-tag, for [SW|SPINE], in [SW|pGP380]: pGP836, available in [SW|Stülke] lab
  • for expression/ purification from ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP844, available in [SW|Stülke] lab
  • labs

  • [SW|Naotake Ogasawara], Nara, Japan
  • References

    Reviews

  • 21885683
  • Original publications

  • 12427945,14762004,11948165,11948146,12837776