SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


inhibitor of [protein|9A1871BD853254EEA8B4E78CA187F9315CBDF43D|LiaS] kinase activity
26.88 kDa
protein length
241 aa Sequence Blast
gene length
726 bp Sequence Blast
control of [protein|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|LiaR] activity
negative effector of [protein|9A1871BD853254EEA8B4E78CA187F9315CBDF43D|LiaS]

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Control of two-component response regulators] → [category|SW|Control of response regulators/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,396,114 → 3,396,839

    The protein

    Catalyzed reaction/ biological activity

  • inhibitor of [protein|9A1871BD853254EEA8B4E78CA187F9315CBDF43D|LiaS] kinase activity, maintains [protein|9A1871BD853254EEA8B4E78CA187F9315CBDF43D|LiaS] in the phosphatase state in the absence of the stress signal [Pubmed|23279150]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|15273097], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|LiaR]: activation, [Pubmed|16816187], in [regulon|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|LiaR regulon]
  • regulation

  • ''[protein|search|liaG]'': constitutive
  • view in new tab



  • ''[protein|search|liaG]'': constitutive
  • view in new tab

    Biological materials


  • MGNA-B037 (yvqF::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE33100 (Δ[gene|C107A958DFA2B0DA4837E2F9F648CD329A3116AC|liaF]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCTGGTGTCCGCCTCC, downstream forward: _UP4_GGTGATGTGGATGTGAAGTA
  • BKK33100 (Δ[gene|C107A958DFA2B0DA4837E2F9F648CD329A3116AC|liaF]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCTGGTGTCCGCCTCC, downstream forward: _UP4_GGTGATGTGGATGTGAAGTA
  • References


  • 27344142
  • Original publications

  • 19164152,20639339,15273097,17660417,16816187,15101989,17660417,16816187,23279150,20817675,22092710,23326432,33114184