SubtiBank SubtiBank
ccpB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ccpB

transcriptional regulator ([SW|LacI family])
locus
BSU_40870
pI
6.33
mw
34.69 kDa
protein length
311 aa Sequence Blast
gene length
936 bp Sequence Blast
function
unknown
product
transcriptional regulator ([SW|LacI family])
essential
no
synonyms
yyaG

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    4,196,786 → 4,197,721

    The protein

    Protein family

  • [SW|LacI family]
  • Structure

  • [PDB|2HSG] (B. megaterium [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA], 30% identity) [pubmed|17500051]
  • Expression and Regulation

    Operons

    genes
    [gene|38CC84343C47CBF37F007E9056A9248869C396E1|exoA]-[gene|C14B113B1A8BEA0547459AA7EC5755634D1A8A88|ccpB]
    description
    (according to [http://dbtbs.hgc.jp/COG/prom/exoA-ccpA.html DBTBS]) null

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|16237020], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed late during sporulation in the forespore ([protein|search|SigG]) [Pubmed|16237020]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B867 (yyaG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1866 NBRP B. subtilis, Japan]
  • BKE40870 (Δ[gene|C14B113B1A8BEA0547459AA7EC5755634D1A8A88|ccpB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCTTTCTCCTTTTCAT, downstream forward: _UP4_TGAACTGAAATGCATTTCAT
  • BKK40870 (Δ[gene|C14B113B1A8BEA0547459AA7EC5755634D1A8A88|ccpB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCTTTCTCCTTTTCAT, downstream forward: _UP4_TGAACTGAAATGCATTTCAT
  • References

  • 9457849,16237020,9457849,17500051