SubtiBank SubtiBank
moeB
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

moeB

molybdopterin biosynthesis protein
locus
BSU_14270
pI
6.09
mw
37.36 kDa
protein length
339 aa Sequence Blast
gene length
1020 bp Sequence Blast
function
nitrate respiration
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.10|Biosynthesis of molybdopterin]
  • Gene

    Coordinates
    1,496,155 → 1,497,174

    The protein

    Catalyzed reaction/ biological activity

  • [molybdopterin-synthase sulfur-carrier protein]-C-terminal Gly-Gly + ATP + H+ --> [molybdopterin-synthase sulfur-carrier protein]-C-terminal Gly-Gly-AMP + diphosphate (according to UniProt)
  • Protein family

  • HesA/MoeB/ThiF family (with [protein|CCD3DDE9E52FCD4906735059CF30593BEB56FD1B|ThiF] and [protein|37DA3A036937660AA750065B46B581D911D73D00|YrvM], according to UniProt)
  • Paralogous protein(s)

  • [protein|CCD3DDE9E52FCD4906735059CF30593BEB56FD1B|ThiF]
  • Structure

  • [PDB|1ZFN] (ThiF from ''E. coli'', 35% identity, 48% similarity) [Pubmed|15896804]
  • Expression and Regulation

    Operons

    genes
    [gene|C6DB8499752ED1DBF276C0E46CC561450BED6A40|mobA]-[gene|C163CF34BAA3A37DCC67851DEE5889BB7AD208AB|moeB]-[gene|03DBD906E31D6A8A4D14C9E2DACF0F1AB9F8DAA8|moeA]-[gene|A283C34375EDF495940E2F03C4FB6A9FE841FA1E|mobB]-[gene|12F27FA4DB8232B52271565C4F4937520A4F5C7B|moaE]-[gene|5C3EAEE1287FFB1541A31B31A8B6627E60A4D2EB|moaD]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE14270 (Δ[gene|C163CF34BAA3A37DCC67851DEE5889BB7AD208AB|moeB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAAACCTGTTCTCCTTA, downstream forward: _UP4_CTGTAACAACAGGAGGGGTC
  • BKK14270 (Δ[gene|C163CF34BAA3A37DCC67851DEE5889BB7AD208AB|moeB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAAACCTGTTCTCCTTA, downstream forward: _UP4_CTGTAACAACAGGAGGGGTC
  • References

    Reviews

  • 23539623
  • Original publications

  • 15896804,22383849