SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


negative regulator of the [SW|fla-che operon], anti-repressor, antagonist [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR] for the repression of the [gene|F6C4634BF871D9A01E27014FFED7527C54BF560D|epsA]→[gene|52A47B49B1FB955EE7E3C316B57A2B4134F78480|epsO] and [gene|8C13E1EF5437DD8F9906643DEDCBB18DABE3B9E3|tapA]-[gene|09B082BF39703F0D9A5980E643175DBD59F5B228|sipW]-[gene|BF97457E986656E4A9FE7A858F5BDF1759850D5C|tasA] operons
6.00 kDa
protein length
gene length
159 bp Sequence Blast
control of motility and biofilm formation
antagonist of [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR] and [protein|920F91E748EE079FF864011D9052B073567C41E4|SlrR]

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Control of transcription factor (other than two-component system)]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.6|Transition state regulators]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW|Regulation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.4|Swarming]
  • Gene

    3,923,319 → 3,923,477


    additional information

  • the mRNA has long 5' and 3' UTRs (170 and 330 nt, respectively) [pubmed|26857544]
  • The protein

    Catalyzed reaction/ biological activity

  • binding of [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR] resulting in induction of [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]-repressed genes and operons [Pubmed|19788541]
  • Paralogous protein(s)

  • [protein|24D6A7DDCB25B99FBB670E9203F826596916B35C|SinI]
  • [SW|Domains]

  • [SW|Sin domain] (aa 1-38) (according to UniProt)
  • Effectors of protein activity

  • [protein|920F91E748EE079FF864011D9052B073567C41E4|SlrR] inhibits activity of [protein|C17C296F3EB2E106C380E3B5D784F3FA63F4C9B7|SlrA] (i. e. binding to [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]) [Pubmed|19788541]
  • Expression and Regulation



    regulatory mechanism

  • [protein|C3D87DAA8DB124D50D2C2B2D424C9608C0DE067F|YwcC]: repression, [Pubmed|18647168,19788541], in [regulon|C3D87DAA8DB124D50D2C2B2D424C9608C0DE067F|YwcC regulon]
  • additional information

  • increased expression in a [gene|64C6D783FF3F41C81B216F798A1DC8071345B1ED|pnpA] mutant [Pubmed|26857544]
  • half-life of the mRNA: 0.56 min, this increases to 1.06 in a [gene|64C6D783FF3F41C81B216F798A1DC8071345B1ED|pnpA] mutant [Pubmed|26857544]
  • RNA degradation by [protein|64C6D783FF3F41C81B216F798A1DC8071345B1ED|PnpA] is proceeds from the 3' end of the mRNA through the [protein|7CD46C64BE69EDADF58B634DC50C3F61BFFEC5B5|Rho]-dependent terminator [Pubmed|26857544]
  • transcription termination depends on [protein|7CD46C64BE69EDADF58B634DC50C3F61BFFEC5B5|Rho] [Pubmed|26857544]
  • view in new tab

    Biological materials


  • BKE38229 (Δ[gene|C17C296F3EB2E106C380E3B5D784F3FA63F4C9B7|slrA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGTAACCTCCAATTGTA, downstream forward: _UP4_TAGTCCGAACAGGCGGATCT
  • BKK38229 (Δ[gene|C17C296F3EB2E106C380E3B5D784F3FA63F4C9B7|slrA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGTAACCTCCAATTGTA, downstream forward: _UP4_TAGTCCGAACAGGCGGATCT
  • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Stülke] lab
  • References

  • 18647168,19788541,23430750,26857544,22329926