SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


c-di-GMP receptor protein, inhibits flagellar rotation at high c-di-GMP concentrations
24.98 kDa
protein length
217 aa Sequence Blast
gene length
654 bp Sequence Blast
control of [protein|search|MotA ]activity
c-di-GMP receptor protein

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.5|Targets of second messengers] → [category|SW 3.5.2|Targets of c-di-GMP]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW|Signal transduction in motility and chemotaxis] → [category|SW|Additional chemotaxis signal transduction and regulatory proteins]
  • Gene

    2,397,019 → 2,397,672

    The protein


  • contains a C-terminal [SW|PilZ domain] (aa 98-203) [Pubmed|22821967]
  • [SW|Cofactors]

  • c-di-GMP [Pubmed|22821967]
  • Effectors of protein activity

  • binding of c-di-GMP stimulates the inhibitory interaction with [protein|86C729C7D5ABEE519ADC4A893940600BBB655EF1|MotA] [Pubmed|22821967]
  • Structure

  • [PDB|5VX6] (complex with c-di-GMP) [pubmed|29196522]
  • [SW|Localization]

  • forms [protein|86C729C7D5ABEE519ADC4A893940600BBB655EF1|MotA]-dependent spots at the membrane [pubmed|29196522]
  • Expression and Regulation


    view in new tab

    view in new tab

    Biological materials


  • MGNA-A419 (ypfA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE22910 (Δ[gene|C194336ED96FA844FFE9FB43BE59ADC5D6DDB3BE|motI]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGACTTCACTCTTTCGC, downstream forward: _UP4_TAAACATCGGCAAACACTTC
  • BKK22910 (Δ[gene|C194336ED96FA844FFE9FB43BE59ADC5D6DDB3BE|motI]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGACTTCACTCTTTCGC, downstream forward: _UP4_TAAACATCGGCAAACACTTC
  • References


  • 25251856,31136265
  • Original Publications

  • 23893111,22821967,29196522,32156823