SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


plipastatin synthetase
144.39 kDa
protein length
1279 aa Sequence Blast
gene length
3840 bp Sequence Blast
production of the antibacterial compound plipastatin
plipastatin synthetase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • Gene

    1,960,198 → 1,964,037

    The protein

    Protein family

  • [SW|ATP-dependent AMP-binding enzyme family] (according to UniProt)
  • Paralogous protein(s)

  • reiterated [protein|1D5F227860A321506A1AB4BAE63CAD3A66E43BFC|SrfAC]-like proteins: [protein|95B75CFF126AF0AD845E62B4036DD3B6DAC8C7FA|DhbF], [protein|E3D7EF8F165CAC2682B0D620081C5C6E555E43C4|PpsA], [protein|E7A2F93B33B1899313893D362D92405232BC9097|PpsB], [protein|D11CE89E2AC2ADE3FEFEC261E295EC5906CE6407|PpsC], [protein|E73D9F1A8F54DAD4B2056CABBE580D7AD36CB042|PpsD], [protein|81845F44CE2C601555066E31E87384FF5D7B4139|SrfAA], [protein|3C484FDB3A440269E87D6B6E8500A875AC456666|SrfAB]
  • partial match (more than 1,000 amino acids): [protein|13EB6B903088C11D985DDB7CEC864797058FE038|PksJ], [protein|66AFF1FC7D1BBA8EA5BB57A935FF5AB890A895C1|PksN]
  • [SW|Domains]

  • [SW|Carrier domain] (aa 975-1050) (according to UniProt)
  • Structure

  • [PDB|2VSQ] ([protein|1D5F227860A321506A1AB4BAE63CAD3A66E43BFC|SrfAC], 40% identity) [pubmed|18583577]
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • Expression and Regulation



    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • view in new tab

    Biological materials


  • BKE18300 (Δ[gene|C1C051209943E02369356075EAA733297E9478CB|ppsE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTCTGCACCTTTCTTCACGG, downstream forward: _UP4_TAAAGCGGATTAGCGGACAG
  • BKK18300 (Δ[gene|C1C051209943E02369356075EAA733297E9478CB|ppsE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTCTGCACCTTTCTTCACGG, downstream forward: _UP4_TAAAGCGGATTAGCGGACAG
  • References

  • 10471562,9387222,21821766,20817675,28009004,18583577