SubtiBank SubtiBank
yhaQ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yhaQ

similar to [SW|ABC transporter] (ATP-binding protein)
locus
BSU_09890
pI
6.10
mw
33.69 kDa
protein length
298 aa Sequence Blast
gene length
897 bp Sequence Blast
function
unknown
product
[SW|ABC transporter] (ATP-binding protein)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.2|Exporters] → [category|SW 1.2.1.2.6|Exporters of unknown function]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,062,591 → 1,063,487

    The protein

    Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • [SW|Domains]

  • [SW|ABC transporter domain] (aa 2-229) (according to UniProt)
  • Structure

  • [PDB|4YER] (from Thermotoga maritima, 27% identity)
  • [SW|Localization]

  • membrane associated (via [protein|887036DE96BD6174EAC2E7201BEEDE99E45EDDF0|YhaP]) [Pubmed|10092453]
  • Expression and Regulation

    Operons

    genes
    [gene|C1FE13182E3E62EBC9650B02DAA0D574332A5F4D|yhaQ]-[gene|887036DE96BD6174EAC2E7201BEEDE99E45EDDF0|yhaP]
    description
    [Pubmed|20817675]

    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675,18840696], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • repressed during logarithmic phase ([protein|search|AbrB]) [Pubmed|18840696]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C044 (natA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2042 NBRP B. subtilis, Japan]
  • BKE09890 (Δ[gene|C1FE13182E3E62EBC9650B02DAA0D574332A5F4D|yhaQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGAATCTCCTCCTTCCC, downstream forward: _UP4_TTTATAGAAAAGGTGGGGGC
  • BKK09890 (Δ[gene|C1FE13182E3E62EBC9650B02DAA0D574332A5F4D|yhaQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGAATCTCCTCCTTCCC, downstream forward: _UP4_TTTATAGAAAAGGTGGGGGC
  • References

  • 10092453,20817675