SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


dihydroorotic acid dehydrogenase (electron transfer subunit)
27.95 kDa
protein length
256 aa Sequence Blast
gene length
771 bp Sequence Blast
pyrimidine biosynthesis
dihydroorotic acid dehydrogenase (electron transfer subunit)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW|Biosynthesis/ acquisition of pyrimidine nucleotides]
  • Gene

    1,626,948 → 1,627,718

    The protein

    Protein family

  • PyrK family (single member, according to UniProt)
  • [SW|Cofactors]

  • [2Fe-2S] cluster [pubmed|29292548,11188687]
  • FAD [pubmed|11188687]
  • Structure

  • [PDB|1EP1] (from Lactococcus lactis, 46% identity) [pubmed|11188687]
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1709162], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|PyrR]: termination/ antitermination, via [SW|RNA switch], in [regulon|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|PyrR regulon]
  • regulation

  • induced in the absence of uridine nucleotides ([protein|search|PyrR]) [Pubmed|8206849]
  • view in new tab

    Biological materials


  • BKE15530 (Δ[gene|C20A05AE4CE8AEE0DA767334935CC64106A7FCCB|pyrK]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACATACTGTCAAATACGCTT, downstream forward: _UP4_AAAGCTCAGGAGGTGGCGCT
  • BKK15530 (Δ[gene|C20A05AE4CE8AEE0DA767334935CC64106A7FCCB|pyrK]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACATACTGTCAAATACGCTT, downstream forward: _UP4_AAAGCTCAGGAGGTGGCGCT
  • References

  • 8206849,8759868,1709162,10545205,15378759,11188687