SubtiBank SubtiBank
rbsK
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

rbsK

ribokinase
locus
BSU_35920
pI
4.61
mw
30.99 kDa
protein length
293 aa Sequence Blast
gene length
882 bp Sequence Blast
function
ribose utilization
product
ribokinase
essential
no
ec
2.7.1.15
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.4|Utilization of ribose]
  • Gene

    Coordinates
    3,702,393 → 3,703,274

    The protein

    Catalyzed reaction/ biological activity

  • ATP + D-ribose --> ADP + D-ribose 5-phosphate + H+ (according to UniProt)
  • Protein family

  • [SW|carbohydrate kinase PfkB family] (according to UniProt)
  • Structure

  • [PDB|1VM7] (the enzyme of ''Thermotoga maritima'', 38% identity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|77AEAC0F06B4D5F062D4A2740794B7BFDDA31096|rbsR]-[gene|C229BD2C00B169CF4A99482E65B3F749AD9D51D8|rbsK]-[gene|F0E6F191FAF8F279462B09BF1FE4C6C752A57803|rbsD]-[gene|AB4A686F62550F90F5BD8D27DAADC9C33F1DA1DB|rbsA]-[gene|F1258E31151E137A850811B0C851D473CEFFD43B|rbsC]-[gene|1D67888E79B09956F9258F4068546D8C67103549|rbsB]
    description
    [Pubmed|7921236]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7511775], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|7921236], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: activation, [Pubmed|7592460], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • expressed upon transition into the stationary phase ([protein|search|AbrB]) [Pubmed|7592460]
  • view in new tab

    Biological materials

    Mutant

  • BKE35920 (Δ[gene|C229BD2C00B169CF4A99482E65B3F749AD9D51D8|rbsK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACCAATCACACAAATATTAC, downstream forward: _UP4_AATGAAGTAGAGGAGCTGCT
  • BKK35920 (Δ[gene|C229BD2C00B169CF4A99482E65B3F749AD9D51D8|rbsK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACCAATCACACAAATATTAC, downstream forward: _UP4_AATGAAGTAGAGGAGCTGCT
  • References

  • 16872404,7511775,7592460,7921236