SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


30.99 kDa
protein length
293 aa Sequence Blast
gene length
882 bp Sequence Blast
ribose utilization

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of ribose]
  • Gene

    3,702,393 → 3,703,274

    The protein

    Catalyzed reaction/ biological activity

  • ATP + D-ribose --> ADP + D-ribose 5-phosphate + H+ (according to UniProt)
  • Protein family

  • [SW|carbohydrate kinase PfkB family] (according to UniProt)
  • Structure

  • [PDB|1VM7] (the enzyme of ''Thermotoga maritima'', 38% identity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7511775], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|7921236], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: activation, [Pubmed|7592460], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • expressed upon transition into the stationary phase ([protein|search|AbrB]) [Pubmed|7592460]
  • view in new tab

    Biological materials


  • BKE35920 (Δ[gene|C229BD2C00B169CF4A99482E65B3F749AD9D51D8|rbsK]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACCAATCACACAAATATTAC, downstream forward: _UP4_AATGAAGTAGAGGAGCTGCT
  • BKK35920 (Δ[gene|C229BD2C00B169CF4A99482E65B3F749AD9D51D8|rbsK]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACCAATCACACAAATATTAC, downstream forward: _UP4_AATGAAGTAGAGGAGCTGCT
  • References

  • 16872404,7511775,7592460,7921236