SubtiBank SubtiBank
yppE
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yppE

unknown
locus
BSU_22270
pI
5.42
mw
14.32 kDa
protein length
123 aa Sequence Blast
gene length
372 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,338,809 → 2,339,180

    The protein

    Structure

  • [PDB|2HFI] (NMR), [PDB|2IM8]
  • Expression and Regulation

    Operons

    genes
    [gene|C8EFD001C76F3C35EFCDF30F50E94769696900D9|yppD]-[gene|C23EE127990420733E6EEE4598B814026C270372|yppE]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • regulation

  • expressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|14651647]
  • view in new tab

    genes
    [gene|C23EE127990420733E6EEE4598B814026C270372|yppE]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A506 (yppE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/506 NBRP B. subtilis, Japan]
  • BKE22270 (Δ[gene|C23EE127990420733E6EEE4598B814026C270372|yppE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATATCTTTCACCTCAATG, downstream forward: _UP4_TAAAAGGCTGTCTTCTTTTC
  • BKK22270 (Δ[gene|C23EE127990420733E6EEE4598B814026C270372|yppE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATATCTTTCACCTCAATG, downstream forward: _UP4_TAAAAGGCTGTCTTCTTTTC
  • References

  • 14651647