SubtiBank SubtiBank
ybzH
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ybzH

putative transcriptional regulator ([SW|ArsR family])
locus
BSU_01889
pI
6.73
mw
12.00 kDa
protein length
100 aa Sequence Blast
gene length
303 bp Sequence Blast
function
unknown
product
putative transcriptional regulator ([SW|ArsR family])
essential
-
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.4|Prophage 1]
  • Gene

    Coordinates
    211,429 → 211,731

    The protein

    Protein family

  • [SW|ArsR family]
  • Structure

  • [PDB|3FWL] (PBP1B from E. coli, 30% identity) [pubmed|19458048]
  • Expression and Regulation

    Operons

    genes
    [gene|C26EAFC9DC4A930F1887E0B99770F5F386A407D3|ybzH]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE01889 (Δ[gene|C26EAFC9DC4A930F1887E0B99770F5F386A407D3|ybzH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01889 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCGATTATTATATCGT, downstream forward: _UP4_TAAAAATAAACATCAAAAGA
  • BKK01889 (Δ[gene|C26EAFC9DC4A930F1887E0B99770F5F386A407D3|ybzH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01889 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCGATTATTATATCGT, downstream forward: _UP4_TAAAAATAAACATCAAAAGA
  • References

  • 23504016,19458048