SubtiBank SubtiBank
ybzH
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ybzH

putative transcriptional regulator ([SW|ArsR family])
locus
BSU_01889
pI
6.73
mw
12.00 kDa
protein length
100 aa Sequence Blast
gene length
303 bp Sequence Blast
function
unknown
product
putative transcriptional regulator ([SW|ArsR family])
essential
-
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.4|Prophage 1]
  • Gene

    Coordinates
    211,429 → 211,731

    The protein

    Protein family

  • [SW|ArsR family]
  • [SW|Domains]

  • [SW|HTH arsR-type domain] (aa 1-100) (according to UniProt)
  • Structure

  • [PDB|3FWL] (PBP1B from E. coli, 30% identity) [pubmed|19458048]
  • Expression and Regulation

    Operons

    genes
    [gene|C26EAFC9DC4A930F1887E0B99770F5F386A407D3|ybzH]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE01889 (Δ[gene|C26EAFC9DC4A930F1887E0B99770F5F386A407D3|ybzH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01889 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCGATTATTATATCGT, downstream forward: _UP4_TAAAAATAAACATCAAAAGA
  • BKK01889 (Δ[gene|C26EAFC9DC4A930F1887E0B99770F5F386A407D3|ybzH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01889 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCGATTATTATATCGT, downstream forward: _UP4_TAAAAATAAACATCAAAAGA
  • References

  • 23504016,19458048