SubtiBank SubtiBank
sipT
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

sipT

signal peptidase I
locus
BSU_14410
pI
9.85
mw
21.71 kDa
protein length
193 aa Sequence Blast
gene length
582 bp Sequence Blast
function
protein secretion
product
signal peptidase I
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.5|Protein secretion]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,511,308 → 1,511,889

    Phenotypes of a mutant

  • a ''[gene|CDC6971F39F3EEAAE912CB1402EE1BD64D5A12A0|sipS] [gene|C2EAE417DB9250B88BB0E25D4AE760BDE82EFD86|sipT]'' double mutant is not viable [Pubmed|9694797]
  • The protein

    Catalyzed reaction/ biological activity

  • Cleavage of hydrophobic, N-terminal signal or leader sequences from secreted and periplasmic proteins (according to UniProt)
  • Protein family

  • [SW|peptidase S26 family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|CDC6971F39F3EEAAE912CB1402EE1BD64D5A12A0|SipS], [protein|9824F9CF9C2028AF267AC43FE7FD8590E8231AB8|SipU], [protein|ADEEA5E15C100C1DC6E129B9A3E6DECAFCA8C409|SipV]
  • Structure

  • [PDB|4NV4] (from B. anthracis, 44% identity)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|C2EAE417DB9250B88BB0E25D4AE760BDE82EFD86|sipT]
    description
    [Pubmed|9694797]

    regulatory mechanism

  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [Pubmed|9694797], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE14410 (Δ[gene|C2EAE417DB9250B88BB0E25D4AE760BDE82EFD86|sipT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14410 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAGTGTTTCCTCCTAGAC, downstream forward: _UP4_TAAAAACGCCTTGCTGGCCT
  • BKK14410 (Δ[gene|C2EAE417DB9250B88BB0E25D4AE760BDE82EFD86|sipT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14410 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAGTGTTTCCTCCTAGAC, downstream forward: _UP4_TAAAAACGCCTTGCTGGCCT
  • labs

  • [SW|Jan Maarten van Dijl], Groningen, Netherlands
  • References

    Reviews

  • 22688815,31286585
  • Original publications

  • 11807061,9325333,9694797,28088521,29358498