SubtiBank SubtiBank
ydfE

ydfE

unknown
locus
BSU_05380
pI
8.75
mw
23.48 kDa
protein length
207 aa Sequence Blast
gene length
624 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    585,155 → 585,778

    The protein

    Protein family

  • flavoredoxin family (with [protein|98D13FCE1FD5EB9C6581F5416F7B4FD40805E047|YwrF], according to UniProt)
  • [SW|Cofactors]

  • FMN or FAD [Pubmed|21635694]
  • Expression and Regulation

    Operons

    genes
    [gene|C30BB71F5DF257ED4A77DFD34EAEF2C05F0F9216|ydfE]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C145 (ydfE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2143 NBRP B. subtilis, Japan]
  • BKE05380 (Δ[gene|C30BB71F5DF257ED4A77DFD34EAEF2C05F0F9216|ydfE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05380 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACGTTTTTTCCTCCTTGT, downstream forward: _UP4_TGATTATTTTAAGACCGAAC
  • BKK05380 (Δ[gene|C30BB71F5DF257ED4A77DFD34EAEF2C05F0F9216|ydfE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05380 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACGTTTTTTCCTCCTTGT, downstream forward: _UP4_TGATTATTTTAAGACCGAAC