SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


allantoate amidohydrolase
45.36 kDa
protein length
412 aa Sequence Blast
gene length
1239 bp Sequence Blast
purine utilization
allantoate amidohydrolase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.1|Utilization of nucleotides]
  • Gene

    3,342,433 → 3,343,671

    The protein

    Catalyzed reaction/ biological activity

  • allantoate + 2 H+ + H2O --> (S)-2-ureidoglycine + CO2 + NH4+ (according to UniProt)
  • Protein family

  • [SW|peptidase M20 family] (according to UniProt)
  • Structure

  • [PDB|2IMO] (from ''Escherichia coli k12'', 47% identity, 63% similarity) [Pubmed|17362992]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12029039], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|52C1601482C26400A524E880334BB801F832D6ED|PucR]: activation, [Pubmed|12029039], in [regulon|52C1601482C26400A524E880334BB801F832D6ED|PucR regulon]
  • regulation

  • induced in the presence of purine nucleotides (inducer: allantoin) ([protein|search|PucR]) [Pubmed|12029039]
  • view in new tab

    Biological materials


  • MGNA-A943 (yurH::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE32530 (Δ[gene|C314CE9D194E8894430368C5F69C0778D45A651C|pucF]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTACTCCCCCCTCTGGC, downstream forward: _UP4_GCTTACTGATAAAGGAGGAA
  • BKK32530 (Δ[gene|C314CE9D194E8894430368C5F69C0778D45A651C|pucF]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTACTCCCCCCTCTGGC, downstream forward: _UP4_GCTTACTGATAAAGGAGGAA
  • References

  • 11344136,12029039