SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


allantoate amidohydrolase
45.36 kDa
protein length
412 aa Sequence Blast
gene length
1239 bp Sequence Blast
purine utilization
allantoate amidohydrolase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.1|Utilization of nucleotides]
  • Gene

    3,342,433 → 3,343,671

    The protein

    Catalyzed reaction/ biological activity

  • allantoate + 2 H+ + H2O --> (S)-2-ureidoglycine + CO2 + NH4+ (according to UniProt)
  • Protein family

  • [SW|peptidase M20 family] (according to UniProt)
  • Structure

  • [PDB|2IMO] (from ''Escherichia coli k12'', 47% identity, 63% similarity) [Pubmed|17362992]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12029039], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|52C1601482C26400A524E880334BB801F832D6ED|PucR]: activation, [Pubmed|12029039], in [regulon|52C1601482C26400A524E880334BB801F832D6ED|PucR regulon]
  • regulation

  • induced in the presence of purine nucleotides (inducer: allantoin) ([protein|search|PucR]) [Pubmed|12029039]
  • view in new tab

    Biological materials


  • MGNA-A943 (yurH::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE32530 (Δ[gene|C314CE9D194E8894430368C5F69C0778D45A651C|pucF]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTACTCCCCCCTCTGGC, downstream forward: _UP4_GCTTACTGATAAAGGAGGAA
  • BKK32530 (Δ[gene|C314CE9D194E8894430368C5F69C0778D45A651C|pucF]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTACTCCCCCCTCTGGC, downstream forward: _UP4_GCTTACTGATAAAGGAGGAA
  • References

  • 11344136,12029039