SubtiBank SubtiBank
rhaEW
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

rhaEW

bifunctional-rhamnulose-phosphate aldolase/L-lactate dehydrogenase
locus
BSU_31220
pI
5.78
mw
75.84 kDa
protein length
689 aa Sequence Blast
gene length
2070 bp Sequence Blast
function
utilizatio of rhamnose and rhamnogalacturonan (pectin)
product
bifunctional-rhamnulose-phosphate aldolase/L-lactate dehydrogenase
essential
no
synonyms
yulA,yuwG

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.12|Utilization of rhamnose]
  • Gene

    Coordinates
    3,201,860 → 3,203,929

    The protein

    Catalyzed reaction/ biological activity

  • rhamnulose-1-phosphate --> dihydroxyacetone-phosphate + L-lactate [Pubmed|24391637]
  • Protein family

  • [SW|Short-chain dehydrogenases/reductases (SDR) family] (according to UniProt)
  • [SW|Cofactors]

  • NAD [Pubmed|24391637]
  • Expression and Regulation

    Operons

    genes
    [gene|C32AE30BF7931D6171E9DE75C67504F81DD0F227|rhaEW]-[gene|F574142C1E61788FF8F4B61280AD4F87292D08DF|rhaR]-[gene|693040A5BA7A25AD485B7B28DBD6E8AAC77450F7|rhaB]-[gene|294C0CC675088B2A2EEFC26FAF1A628002B82C59|rhaM]-[gene|FDDC16D57752D81299CDD426257C1CD49890C89C|rhaA]
    description
    [Pubmed|26712933,22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|26712933], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|F574142C1E61788FF8F4B61280AD4F87292D08DF|RhaR]: repression, [Pubmed|26712933], in [regulon|F574142C1E61788FF8F4B61280AD4F87292D08DF|RhaR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|26712933], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • expression during spore [SW|germination] is increased under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A638 (yuxG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/638 NBRP B. subtilis, Japan]
  • BKE31220 (Δ[gene|C32AE30BF7931D6171E9DE75C67504F81DD0F227|rhaEW]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31220 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTGATATTCCTCCAT, downstream forward: _UP4_TAGATATATGCTATGATAAA
  • BKK31220 (Δ[gene|C32AE30BF7931D6171E9DE75C67504F81DD0F227|rhaEW]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31220 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTGATATTCCTCCAT, downstream forward: _UP4_TAGATATATGCTATGATAAA
  • References

  • 26712933,24391637,22383849