SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


bifunctional-rhamnulose-phosphate aldolase/L-lactate dehydrogenase
75.84 kDa
protein length
689 aa Sequence Blast
gene length
2070 bp Sequence Blast
utilizatio of rhamnose and rhamnogalacturonan (pectin)
bifunctional-rhamnulose-phosphate aldolase/L-lactate dehydrogenase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of rhamnose]
  • Gene

    3,201,860 → 3,203,929

    The protein

    Catalyzed reaction/ biological activity

  • rhamnulose-1-phosphate --> dihydroxyacetone-phosphate + L-lactate [Pubmed|24391637]
  • Protein family

  • [SW|Short-chain dehydrogenases/reductases (SDR) family] (according to UniProt)
  • [SW|Cofactors]

  • NAD [Pubmed|24391637]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|26712933], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|F574142C1E61788FF8F4B61280AD4F87292D08DF|RhaR]: repression, [Pubmed|26712933], in [regulon|F574142C1E61788FF8F4B61280AD4F87292D08DF|RhaR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|26712933], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • expression during spore [SW|germination] is increased under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    Biological materials


  • MGNA-A638 (yuxG::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE31220 (Δ[gene|C32AE30BF7931D6171E9DE75C67504F81DD0F227|rhaEW]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTGATATTCCTCCAT, downstream forward: _UP4_TAGATATATGCTATGATAAA
  • BKK31220 (Δ[gene|C32AE30BF7931D6171E9DE75C67504F81DD0F227|rhaEW]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTGATATTCCTCCAT, downstream forward: _UP4_TAGATATATGCTATGATAAA
  • References

  • 26712933,24391637,22383849