SubtiBank SubtiBank
nth
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

nth

apurinic/apyrimidinic endonuclease , endonuclease III, removes abasic sites during base excision repair
locus
BSU_22340
pI
9.28
mw
24.85 kDa
protein length
219 aa Sequence Blast
gene length
660 bp Sequence Blast
function
DNA repair
product
endonuclease III
essential
no
synonyms
jooB,ypoB

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW 3.1.5.2|A/P endonucleases]
  • Gene

    Coordinates
    2,344,755 → 2,345,414

    Phenotypes of a mutant

  • the mutant is sensititive to exposure to H2O2 [Pubmed|21954439]
  • The protein

    Catalyzed reaction/ biological activity

  • The C-O-P bond 3' to the apurinic or apyrimidinic site in DNA is broken by a beta-elimination reaction, leaving a 3'-terminal unsaturated sugar and a product with a terminal 5'-phosphate (according to UniProt)
  • Protein family

  • Nth/MutY family (with [protein|B62083CF18FC4C796D95B960CF62FA963FC26CDE|MutY], according to UniProt)
  • [SW|Domains]

  • HhH domain (aa 109-128) (according to UniProt)
  • [SW|Cofactors]

  • Fe-S cluster [pubmed|29292548]
  • Effectors of protein activity

  • activity is stimulated by untwisting of the DNA (by [protein|C9FEE07601AD28B2651EB881A1D9B34D5082237C|DnaD], [protein|EFD8FC875B6787B1512C5FC4C81E7E4C9BD93028|Hbs], or [protein|3FFFA28E2C16508C6A94408B739864DB7F8DD1F7|YonN]) [Pubmed|21954439]
  • Structure

  • [PDB|1P59] (complex with DNA, Geobacillus stearothermophilus)
  • Expression and Regulation

    Operons

    genes
    [gene|FBA7EAA70F5C9E76463B0C5F85D65D4314FFD40D|asnS]-[gene|C9FEE07601AD28B2651EB881A1D9B34D5082237C|dnaD]-[gene|C352560155F5B2E951B5059794D7B319C1A3AF2C|nth]-[gene|4B2A124B726393544A47791E5A5681F7B766A588|ypoC]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|C9FEE07601AD28B2651EB881A1D9B34D5082237C|dnaD]-[gene|C352560155F5B2E951B5059794D7B319C1A3AF2C|nth]
    description
    [Pubmed|21954439]

    regulation

  • constitutively expressed [Pubmed|21954439]
  • view in new tab

    Biological materials

    Mutant

  • BKE22340 (Δ[gene|C352560155F5B2E951B5059794D7B319C1A3AF2C|nth]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAACACGATTGTCACCTTTT, downstream forward: _UP4_GATAAAAAAGGACTGGTGAA
  • BKK22340 (Δ[gene|C352560155F5B2E951B5059794D7B319C1A3AF2C|nth]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAACACGATTGTCACCTTTT, downstream forward: _UP4_GATAAAAAAGGACTGGTGAA
  • References

    Reviews

  • 22933559
  • Original publications

  • 12840008,21954439,24914186