SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


NADPH:ferredoxin oxidoreductase
36.81 kDa
protein length
336 aa Sequence Blast
gene length
1011 bp Sequence Blast
NADPH:ferredoxin oxidoreductase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.4|Electron transport/ other/ based on similarity]
  • Gene

    352,858 → 353,868

    The protein

    Catalyzed reaction/ biological activity

  • H+ + NADP+ + 2 reduced [2Fe-2S]-[ferredoxin] --> NADPH + 2 oxidized [2Fe-2S]-[ferredoxin] (according to UniProt)
  • Protein family

  • ferredoxin--NADP reductase type 2 family (with [protein|BAA74A6971CED9FB55540F1BC602CDA287D83E74|YumC], according to UniProt)
  • Paralogous protein(s)

  • [protein|BAA74A6971CED9FB55540F1BC602CDA287D83E74|YumC]
  • [SW|Cofactors]

  • FAD [Pubmed|25826316]
  • Structure

  • [PDB|5XHU]
  • Additional information

  • The gene is annotated in KEGG as an ortholog of thioredoxin reductase (NADPH) EC In MetaCyc the protein is marked as “similar to thioredoxin
  • reductase”. No EC annotation is available in Swiss-Prot. No literature/experimental evidence supporting the annotation is available. [Pubmed|19935659]
  • Expression and Regulation



    regulatory mechanism

  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [Pubmed|16672620], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • regulation

  • induced under conditions of iron starvation ([protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]) [Pubmed|16672620]
  • additional information

  • the mRNA is very stable (half-life > 15 min) [Pubmed|12884008]
  • view in new tab

    Biological materials


  • MGNA-C052 (ycgT::erm), available at the [ NBRP B. subtilis, Japan]
  • GP1852 (Δ[gene|C35A302F0B0BC724EC91B47AB4D38CF56CADD574|ycgT]::cat), available in [SW|Jörg Stülke]'s lab
  • BKE03270 (Δ[gene|C35A302F0B0BC724EC91B47AB4D38CF56CADD574|ycgT]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCGTCCTGCCTCCCGTT, downstream forward: _UP4_TAAAACAGCCCTTGAGGAAA
  • BKK03270 (Δ[gene|C35A302F0B0BC724EC91B47AB4D38CF56CADD574|ycgT]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCGTCCTGCCTCCCGTT, downstream forward: _UP4_TAAAACAGCCCTTGAGGAAA
  • References

  • 12884008,16672620,25826316,20878669