SubtiBank SubtiBank
gudB
The papers of the month are back! Check them out! Link here

gudB

glutamate dehydrogenase, trigger enzyme
locus
BSU22960
pI
5.58
mw
47.05 kDa
protein length
426 aa Sequence Blast
gene length
1278 bp Sequence Blast
function
glutamate utilization, control of [protein|87BCAE725B02860156D50E1783F6DB68510C811E|GltC] activity
product
glutamate dehydrogenase, trigger enzyme
essential
no
ec
1.4.1.2
synonyms
ypcA

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.1|Utilization of glutamine/ glutamate]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.7|Control of transcription factor (other than two-component system)]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.3|Trigger enzyme] → [category|SW 3.4.3.2|Trigger enzymes that control gene expression by protein-protein interaction with transcription factors]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    2,402,067 → 2,403,350

    Phenotypes of a mutant

  • The gene is cryptic. If [gene|C36C8C9EEDCAD392D9BEC9728A1E0CBFF2F4E790|gudB] is activated (gudB1 mutation), the bacteria are able to utilize glutamate as the only carbon source. [http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=+18326565 PubMed]
  • A [gene|56CBEBCFEF5CFB4A0175498338C7AF2F45EAA3E3|rocG] [gene|C36C8C9EEDCAD392D9BEC9728A1E0CBFF2F4E790|gudB] mutant is sensitive to ß-lactam antibiotics such as cefuroxime and to fosfomycin due to the downregulation of the [SW|SigW regulon] [Pubmed|22178969]
  • transcription profile of a [gene|56CBEBCFEF5CFB4A0175498338C7AF2F45EAA3E3|rocG] [gene|C36C8C9EEDCAD392D9BEC9728A1E0CBFF2F4E790|gudB] mutant strain: [http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE34383&submit.x=22&submit.y=9 GEO] [Pubmed|22178969]
  • The protein

    Catalyzed reaction/ biological activity

  • L-glutamate + H2O + NAD+ = 2-oxoglutarate + NH3 + NADH + H+ (according to Swiss-Prot)
  • Protein family

  • Glu/Leu/Phe/Val dehydrogenases family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|56CBEBCFEF5CFB4A0175498338C7AF2F45EAA3E3|RocG]
  • Modification

  • phosphorylated on Arg-56, Arg-83, and Arg-421 and/or Arg-423 [Pubmed|22517742]
  • [SW|Cofactors]

  • NAD+/NADH + H+
  • Structure

  • [PDB|3K8Z] (enzymatically active GudB1) [Pubmed|20630473]
  • additional information

  • GudB is subject to Clp-dependent proteolysis upon glucose starvation [PubMed|17981983]
  • Expression and Regulation

    Operons

    genes
    [gene|C36C8C9EEDCAD392D9BEC9728A1E0CBFF2F4E790|gudB]
    description
    [Pubmed|22178973]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [PubMed|9829940], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulation

  • constitutively expressed [Pubmed|22178973]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A397 (ypcA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/397 NBRP B. subtilis, Japan]
  • GP691 (''ΔgudB::cat''), GP1160 (''ΔgudB::aphA3'') both available in [SW|Jörg Stülke]'s lab
  • BKE22960 (Δ[gene|C36C8C9EEDCAD392D9BEC9728A1E0CBFF2F4E790|gudB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGAGTTAACCTCCTAG, downstream forward: _UP4_TAAGTTGATGATTTGCATAA
  • BKK22960 (Δ[gene|C36C8C9EEDCAD392D9BEC9728A1E0CBFF2F4E790|gudB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGAGTTAACCTCCTAG, downstream forward: _UP4_TAAGTTGATGATTTGCATAA
  • Expression vector

  • for purification of GudB from ''E. coli'' carrying an N-terminal Strep-tag: pGP863 (in [SW|pGP172]) available in [SW|Jörg Stülke]'s lab
  • for purification of GudB1 from ''E. coli'' carrying an N-terminal Strep-tag: pGP864 (in [SW|pGP172]) available in [SW|Jörg Stülke]'s lab
  • for ectopic expression of ''gudB'' with its native promoter: pGP900 (in [protein|search|pAC5]), available in [SW|Jörg Stülke]'s lab
  • wild type ''gudB'', expression in ''B. subtilis'', in [SW|pBQ200]: pGP1712, available in [SW|Jörg Stülke]'s lab
  • pBP179 (N-terminal Strep-tag ''gudB+'', purification from ''B. subtilis'', for [SW|SPINE], in [SW|pGP380]), available in [SW|Fabian Commichau]'s lab
  • lacZ fusion

  • pGP651 (in [protein|search|pAC5]), available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW| Fabian Commichau]'s lab
  • FLAG-tag construct

  • GP1194 (''gudB'', ''spc'', based on [SW|pGP1331]), GP1195 (''gudB1'', ''spc'', based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • Antibody

  • antibody against [protein|56CBEBCFEF5CFB4A0175498338C7AF2F45EAA3E3|RocG] recognizes GudB, available in [SW|Jörg Stülke]'s lab
  • Labs working on this gene/protein

  • [SW|Linc Sonenshein], Tufts University, Boston, MA, USA [http://www.tufts.edu/sackler/microbiology/faculty/sonenshein/index.html Homepage]
  • [SW|Fabian Commichau] University of Göttingen, Germany [http://genmibio.uni-goettingen.de/index.php?id=130 Homepage]
  • References

    Reviews

  • 19698086,8299344,7705101,19895831,22625175,28615289
  • Original publications

  • 18603778,9829940,17183217,18723616,18326565,20630473,17981983,21219666,22178973,22517742,23338837,22178969,23785476,24263382,24473333,25610436,25711804,28468957,28516784