SubtiBank SubtiBank
putR
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

putR

transcriptional activator of the proline utilization operon [gene|1F548515402950572E7212901729B2480432D1B9|putB]-[gene|2042F691CB37B1BAFE2CF3906A9F7F47457C3995|putC]-[gene|B3DF99B747D0A7472E3878920BF3CE7CE954B0BE|putP]
locus
BSU_03230
pI
5.37
mw
47.67 kDa
protein length
411 aa Sequence Blast
gene length
1236 bp Sequence Blast
function
regulation of proline utilization
product
transcriptional activator ([SW|PucR family])
essential
no
synonyms
ycgP,prcR

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.2|Utilization of proline]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    348,724 → 349,959

    Phenotypes of a mutant

  • no growth with proline as single source of carbon or nitrogen [Pubmed|21840319]
  • The protein

    Catalyzed reaction/ biological activity

  • transcription activation of the proline utilization operon ''[gene|1F548515402950572E7212901729B2480432D1B9|putB]-[gene|2042F691CB37B1BAFE2CF3906A9F7F47457C3995|putC]-[gene|B3DF99B747D0A7472E3878920BF3CE7CE954B0BE|putP]'' in the presence of proline [Pubmed|21840319,21964733]
  • Protein family

  • [SW|PucR family]
  • [SW|CdaR family] (according to UniProt)
  • [SW|Cofactors]

  • proline acts as co-activator [Pubmed|21840319]
  • Effectors of protein activity

  • proline activates PutR [Pubmed|21840319]
  • Expression and Regulation

    Operons

    genes
    [gene|C37D1CCBDE6DCEAB0AFACF8CBB3F733FE08324EE|putR]
    description
    [Pubmed|21840319]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|21964733], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulation

  • constitutively expressed [Pubmed|21840319,21964733]
  • view in new tab

    Biological materials

    Mutant

  • BKE03230 (Δ[gene|C37D1CCBDE6DCEAB0AFACF8CBB3F733FE08324EE|putR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACCTTTTTCTCCTATAC, downstream forward: _UP4_TAAAAAAGAAACCAGTACTT
  • BKK03230 (Δ[gene|C37D1CCBDE6DCEAB0AFACF8CBB3F733FE08324EE|putR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACCTTTTTCTCCTATAC, downstream forward: _UP4_TAAAAAAGAAACCAGTACTT
  • References

  • 21840319,21964733,22139509