The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

putR

transcriptional activator of the proline utilization operon [gene|1F548515402950572E7212901729B2480432D1B9|putB]-[gene|2042F691CB37B1BAFE2CF3906A9F7F47457C3995|putC]-[gene|B3DF99B747D0A7472E3878920BF3CE7CE954B0BE|putP]

locus: BSU_03230

pI: 5.37

mw: 47.67 kDa

protein length: 411 aa

gene length: 1236 bp

function: regulation of proline utilization

product: transcriptional activator ([SW|PucR family])

essential: no

synonyms: ycgP,prcR

Genomic Context

categories

• [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.2|Utilization of proline]
• [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]

Gene

Coordinates: 348,724 → 349,959

Phenotypes of a mutant

• no growth with proline as single source of carbon or nitrogen [Pubmed|21840319]

The protein

Catalyzed reaction/ biological activity

• transcription activation of the proline utilization operon ''[gene|1F548515402950572E7212901729B2480432D1B9|putB]-[gene|2042F691CB37B1BAFE2CF3906A9F7F47457C3995|putC]-[gene|B3DF99B747D0A7472E3878920BF3CE7CE954B0BE|putP]'' in the presence of proline [Pubmed|21840319,21964733]

Protein family

• [SW|PucR family]
• [SW|CdaR family] (according to UniProt)

[SW|Cofactors]

• proline acts as co-activator [Pubmed|21840319]

Effectors of protein activity

• proline activates PutR [Pubmed|21840319]

Expression and Regulation

Operons

• genes: [gene|C37D1CCBDE6DCEAB0AFACF8CBB3F733FE08324EE|putR]
  description: [Pubmed|21840319]

  sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|21964733], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]

  regulation

  • constitutively expressed [Pubmed|21840319,21964733]

Biological materials

Mutant

• BKE03230 (Δ[gene|C37D1CCBDE6DCEAB0AFACF8CBB3F733FE08324EE|putR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACCTTTTTCTCCTATAC, downstream forward: _UP4_TAAAAAAGAAACCAGTACTT
• BKK03230 (Δ[gene|C37D1CCBDE6DCEAB0AFACF8CBB3F733FE08324EE|putR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACCTTTTTCTCCTATAC, downstream forward: _UP4_TAAAAAAGAAACCAGTACTT

References

• 21840319,21964733,22139509