SubtiBank SubtiBank
The papers of the month are back! Check them out! Link here


transcriptional activator of the proline utilization operon putB-putC-putP
47.67 kDa
protein length
411 aa Sequence Blast
gene length
1233 bp Sequence Blast
regulation of proline utilization
transcriptional activator (PucR family)
ycgP, prcR

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW|Utilization of proline]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • Gene

    348,724 → 349,959

    Phenotypes of a mutant

  • no growth with proline as single source of carbon or nitrogen [Pubmed|21840319]
  • The protein

    Catalyzed reaction/ biological activity

  • transcription activation of the proline utilization operon ''[gene|1F548515402950572E7212901729B2480432D1B9|putB]-[gene|2042F691CB37B1BAFE2CF3906A9F7F47457C3995|putC]-[gene|B3DF99B747D0A7472E3878920BF3CE7CE954B0BE|putP]'' in the presence of proline [Pubmed|21840319,21964733]
  • Protein family

  • [SW|PucR family]
  • [SW|Cofactors]

  • proline acts as co-activator [Pubmed|21840319]
  • Effectors of protein activity

  • proline activates PutR [Pubmed|21840319]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|21964733], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulation

  • constitutively expressed [Pubmed|21840319,21964733]
  • view in new tab

    Biological materials


  • BKE03230 (Δ[gene|C37D1CCBDE6DCEAB0AFACF8CBB3F733FE08324EE|putR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACCTTTTTCTCCTATAC, downstream forward: _UP4_TAAAAAAGAAACCAGTACTT
  • BKK03230 (Δ[gene|C37D1CCBDE6DCEAB0AFACF8CBB3F733FE08324EE|putR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACCTTTTTCTCCTATAC, downstream forward: _UP4_TAAAAAAGAAACCAGTACTT
  • References

  • 21840319,21964733,22139509