SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


fructosamine kinase
30.83 kDa
protein length
284 aa Sequence Blast
gene length
855 bp Sequence Blast
metabolism of sugar amines
fructosamine kinase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of amino sugars]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW|Utilization of amino sugars]
  • Gene

    3,347,051 → 3,347,905

    The protein

    Protein family

  • [SW|carbohydrate kinase PfkB family] (according to UniProt)
  • Structure

  • [PDB|1TYY] (from Salmonella typhimurium, 24% identity) [pubmed|15458630]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [pubmed|22383849], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [pubmed|12618455], [pubmed|18083814], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|412A1DBBE7F87765DEBEEAAE02A047636A354D5E|FrlR]: repression, [Pubmed|21398478], in [regulon|412A1DBBE7F87765DEBEEAAE02A047636A354D5E|FrlR regulon]
  • [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR]: regulation, [pubmed|30355672], in [regulon|F4097349A563503468A2A14F062AEAC532C7917A|YlxR regulon]
  • regulation

  • '' [protein|C87E74FB67B53DD1C68916AA121388C60CE66E92|FrlB]'': repressed during growth in the presence of branched chain amino acids ([protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]) [Pubmed|12618455]
  • induced in the absence of [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR] [pubmed|30355672]
  • additional information

  • the [gene|C87E74FB67B53DD1C68916AA121388C60CE66E92|frlB]-[gene|9E3FF9D0B33D7EFEA3B61FF863BB46CC6DFD4F9B|frlO]-[gene|8256CAAEC591E40A8CB172FF053E03BFFD5A4B54|frlN]-[gene|1F245030D0C81DC96FC0642199CA00579CF46D06|frlM]-[gene|C3823AFED3E5C3D1EA04C38D861239468C9E6349|frlD]-[gene|3B9331D6755B8253944AB33521BBF2B3EBA4CAEB|yurJ] operon is strongly downregulated in a [gene|search|cshA ]mutant [Pubmed|23175651]
  • view in new tab

    Biological materials


  • MGNA-A558 (yurL::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE32570 (Δ[gene|C3823AFED3E5C3D1EA04C38D861239468C9E6349|frlD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATCAATTTCATAGCGCTTC, downstream forward: _UP4_TAAGCAGTGTCTCGTTTTTT
  • BKK32570 (Δ[gene|C3823AFED3E5C3D1EA04C38D861239468C9E6349|frlD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATCAATTTCATAGCGCTTC, downstream forward: _UP4_TAAGCAGTGTCTCGTTTTTT
  • References

  • 23175651,21815947,15556630,16153181,21347729,12618455,21398478,15458630