SubtiBank SubtiBank
frlD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

frlD

fructosamine kinase
locus
BSU_32570
pI
4.91
mw
30.83 kDa
protein length
284 aa Sequence Blast
gene length
855 bp Sequence Blast
function
metabolism of sugar amines
product
fructosamine kinase
essential
no
synonyms
yurL

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.17|Utilization of amino sugars]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW 2.3.3.3|Utilization of amino sugars]
  • Gene

    Coordinates
    3,347,051 → 3,347,905

    The protein

    Protein family

  • [SW|carbohydrate kinase PfkB family] (according to UniProt)
  • Structure

  • [PDB|1TYY] (from Salmonella typhimurium, 24% identity) [pubmed|15458630]
  • Expression and Regulation

    Operons

    genes
    [gene|C87E74FB67B53DD1C68916AA121388C60CE66E92|frlB]-[gene|9E3FF9D0B33D7EFEA3B61FF863BB46CC6DFD4F9B|frlO]-[gene|8256CAAEC591E40A8CB172FF053E03BFFD5A4B54|frlN]-[gene|1F245030D0C81DC96FC0642199CA00579CF46D06|frlM]-[gene|C3823AFED3E5C3D1EA04C38D861239468C9E6349|frlD]-[gene|3B9331D6755B8253944AB33521BBF2B3EBA4CAEB|yurJ]
    description
    [Pubmed|23175651,21347729,22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [pubmed|22383849], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [pubmed|12618455], [pubmed|18083814], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|412A1DBBE7F87765DEBEEAAE02A047636A354D5E|FrlR]: repression, [Pubmed|21398478], in [regulon|412A1DBBE7F87765DEBEEAAE02A047636A354D5E|FrlR regulon]
  • [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR]: regulation, [pubmed|30355672], in [regulon|F4097349A563503468A2A14F062AEAC532C7917A|YlxR regulon]
  • regulation

  • '' [protein|C87E74FB67B53DD1C68916AA121388C60CE66E92|FrlB]'': repressed during growth in the presence of branched chain amino acids ([protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]) [Pubmed|12618455]
  • induced in the absence of [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR] [pubmed|30355672]
  • additional information

  • the [gene|C87E74FB67B53DD1C68916AA121388C60CE66E92|frlB]-[gene|9E3FF9D0B33D7EFEA3B61FF863BB46CC6DFD4F9B|frlO]-[gene|8256CAAEC591E40A8CB172FF053E03BFFD5A4B54|frlN]-[gene|1F245030D0C81DC96FC0642199CA00579CF46D06|frlM]-[gene|C3823AFED3E5C3D1EA04C38D861239468C9E6349|frlD]-[gene|3B9331D6755B8253944AB33521BBF2B3EBA4CAEB|yurJ] operon is strongly downregulated in a [gene|search|cshA ]mutant [Pubmed|23175651]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A558 (yurL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/558 NBRP B. subtilis, Japan]
  • BKE32570 (Δ[gene|C3823AFED3E5C3D1EA04C38D861239468C9E6349|frlD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATCAATTTCATAGCGCTTC, downstream forward: _UP4_TAAGCAGTGTCTCGTTTTTT
  • BKK32570 (Δ[gene|C3823AFED3E5C3D1EA04C38D861239468C9E6349|frlD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATCAATTTCATAGCGCTTC, downstream forward: _UP4_TAAGCAGTGTCTCGTTTTTT
  • References

  • 23175651,21815947,15556630,16153181,21347729,12618455,21398478,15458630