SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


transcription repressor ([SW|TetR family]), controls [gene|C17C296F3EB2E106C380E3B5D784F3FA63F4C9B7|slrA] expression
25.96 kDa
protein length
223 aa Sequence Blast
gene length
672 bp Sequence Blast
control of [gene|C17C296F3EB2E106C380E3B5D784F3FA63F4C9B7|slrA] expression
transcription repressor ([SW|TetR family])

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW|Other proteins required for biofilm formation]
  • Gene

    3,922,292 → 3,922,963

    The protein

    Protein family

  • [SW|TetR family]
  • Expression and Regulation




  • repressed by glucose ([protein|search|CcpA]) [Pubmed|10666464]
  • view in new tab

    Biological materials


  • MGNA-B230 (ywcC::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE38220 (Δ[gene|C3D87DAA8DB124D50D2C2B2D424C9608C0DE067F|ywcC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTTTCTCCTGGCGGT, downstream forward: _UP4_CAGTGAAGTATAGAGAAATA
  • BKK38220 (Δ[gene|C3D87DAA8DB124D50D2C2B2D424C9608C0DE067F|ywcC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTTTCTCCTGGCGGT, downstream forward: _UP4_CAGTGAAGTATAGAGAAATA
  • References


  • 24006471
  • Original publications

  • 18647168,22383849,22893383,19788541,27891125