SubtiBank SubtiBank
The papers of the month are back! Check them out! Link here


transcription repressor (TetR family), controls slrA expression
25.96 kDa
protein length
223 aa Sequence Blast
gene length
669 bp Sequence Blast
control of SlrA expression
transcription repressor (TetR family)

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW|Other proteins required for biofilm formation]
  • Gene

    3,922,292 → 3,922,963

    The protein

    Protein family

  • [SW|TetR family]
  • Expression and Regulation




  • repressed by glucose ([protein|search|CcpA]) [Pubmed|10666464]
  • view in new tab

    Biological materials


  • MGNA-B230 (ywcC::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE38220 (Δ[gene|C3D87DAA8DB124D50D2C2B2D424C9608C0DE067F|ywcC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTTTCTCCTGGCGGT, downstream forward: _UP4_CAGTGAAGTATAGAGAAATA
  • BKK38220 (Δ[gene|C3D87DAA8DB124D50D2C2B2D424C9608C0DE067F|ywcC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTTTCTCCTGGCGGT, downstream forward: _UP4_CAGTGAAGTATAGAGAAATA
  • References


  • 24006471
  • Original publications

  • 18647168,22383849,22893383,19788541,27891125