dgcK

diguanylate cyclase

locus: BSU_09120

pI: 8.57

mw: 40.53 kDa

protein length: 359 aa

gene length: 1080 bp

function: synthesis of c-di-GMP

product: diguanylate cyclase

essential: no

synonyms: yhcK

Genomic Context

categories

• [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.3|Metabolism of signalling nucleotides]
• [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]

Gene

Coordinates: 985,734 → 986,813

The protein

Catalyzed reaction/ biological activity

• synthesis of c-di-GMP from two molecules of GTP [Pubmed|23893111]

[SW|Domains]

• six transmembrane helices at the N-terminus (according to UniProt?)
• contains a C-terminal [SW|GGDEF domain] (aa 223-357) [Pubmed|22821967]

Structure

• [PDB|2WB4] (the C-terminal [SW|GGDEF domain], PleD from Caulobacter vibrioides, 44% identity)

[SW|Localization]

• cell membrane at cell poles and septa, probably close to [protein|70ED3CE683F3A3F785480F40986CABE7729C17C7|YdaK] [pubmed|28536559]
• present at a single site in the cell membrane [pubmed|32156823]

additional information

• DgcK is present with about 6 molecules per cell [pubmed|32156823]

Expression and Regulation

Operons

• genes: [gene|C43AE224400421CCDA7022C915ECC7525E30EB1D|dgcK]
  description: [pubmed|22383849]

Biological materials

Mutant

• MGNA-A656 (yhcK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/656 NBRP B. subtilis, Japan]
• GP848 (''[gene|C43AE224400421CCDA7022C915ECC7525E30EB1D|dgcK]''::''ermC''), available in [SW|Jörg Stülke]'s lab [pubmed|28420751]
• BKE09120 (Δ[gene|C43AE224400421CCDA7022C915ECC7525E30EB1D|dgcK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATATTATCACCCTTATA, downstream forward: _UP4_TGAATTCAATGTTCGAATTC
• BKK09120 (Δ[gene|C43AE224400421CCDA7022C915ECC7525E30EB1D|dgcK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATATTATCACCCTTATA, downstream forward: _UP4_TGAATTCAATGTTCGAATTC

References

• 23893111,22821967,27116468,28536559,32156823