SubtiBank SubtiBank
dgcK
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

dgcK

diguanylate cyclase
locus
BSU_09120
pI
8.57
mw
40.53 kDa
protein length
359 aa Sequence Blast
gene length
1080 bp Sequence Blast
function
synthesis of c-di-GMP
product
diguanylate cyclase
essential
no
synonyms
yhcK

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.3|Metabolism of signalling nucleotides]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    985,734 → 986,813

    The protein

    Catalyzed reaction/ biological activity

  • synthesis of c-di-GMP from two molecules of GTP [Pubmed|23893111]
  • [SW|Domains]

  • six transmembrane helices at the N-terminus (according to UniProt?)
  • contains a C-terminal [SW|GGDEF domain] (aa 223-357) [Pubmed|22821967]
  • Structure

  • [PDB|2WB4] (the C-terminal [SW|GGDEF domain], PleD from Caulobacter vibrioides, 44% identity)
  • [SW|Localization]

  • cell membrane at cell poles and septa, probably close to [protein|70ED3CE683F3A3F785480F40986CABE7729C17C7|YdaK] [pubmed|28536559]
  • present at a single site in the cell membrane [pubmed|32156823]
  • additional information

  • DgcK is present with about 6 molecules per cell [pubmed|32156823]
  • Expression and Regulation

    Operons

    genes
    [gene|C43AE224400421CCDA7022C915ECC7525E30EB1D|dgcK]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A656 (yhcK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/656 NBRP B. subtilis, Japan]
  • GP848 (''[gene|C43AE224400421CCDA7022C915ECC7525E30EB1D|dgcK]''::''ermC''), available in [SW|Jörg Stülke]'s lab [pubmed|28420751]
  • BKE09120 (Δ[gene|C43AE224400421CCDA7022C915ECC7525E30EB1D|dgcK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATATTATCACCCTTATA, downstream forward: _UP4_TGAATTCAATGTTCGAATTC
  • BKK09120 (Δ[gene|C43AE224400421CCDA7022C915ECC7525E30EB1D|dgcK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATATTATCACCCTTATA, downstream forward: _UP4_TGAATTCAATGTTCGAATTC
  • References

  • 23893111,22821967,27116468,28536559,32156823