SubtiBank SubtiBank
ywoH
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ywoH

similar to transcriptional regulator ([SW|MarR family])
locus
BSU_36440
pI
8.10
mw
16.28 kDa
protein length
137 aa Sequence Blast
gene length
414 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • Gene

    Coordinates
    3,749,052 → 3,749,465

    The protein

    Structure

  • [PDB|3NRV] (from Acinetobacter sp., 27% identity)
  • Biological materials

    Mutant

  • MGNA-A217 (ywoH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/217 NBRP B. subtilis, Japan]
  • BKE36440 (Δ[gene|C44717EB77EBB904451F838B69050D08040B30E2|ywoH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36440 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCGGTCTCCTTCTAAA, downstream forward: _UP4_TGAAAATAAGGAAGTGACAT
  • BKK36440 (Δ[gene|C44717EB77EBB904451F838B69050D08040B30E2|ywoH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36440 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCGGTCTCCTTCTAAA, downstream forward: _UP4_TGAAAATAAGGAAGTGACAT