SubtiBank SubtiBank
yqgO
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yqgO

unknown
locus
BSU_24880
pI
12.21
mw
6.78 kDa
protein length
gene length
174 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    2,573,520 → 2,573,693

    Expression and Regulation

    Operons

    genes
    [gene|89C51789FBB2EE86771ABD8629FD99748ED5D4EF|yqgP]-[gene|C44F6723A2F1A627A0B9042871A07F5365D6121A|yqgO]-[gene|8E10A8B566BC25CBDDEF1503656A4234FD29ACB8|glcK]-[gene|2B33F2F9C2FB0767B72A29D060037393C88ACEE5|yqgS]
    description
    [pubmed|22383849]

    additional information

  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]∼P binds to the promoter region, but regulation has not been explored [pubmed|25666134]
  • view in new tab

    Biological materials

    Mutant

  • BKE24880 (Δ[gene|C44F6723A2F1A627A0B9042871A07F5365D6121A|yqgO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATATCCCTCCTGCCAA, downstream forward: _UP4_TAAAATCCCGTGAAAAACGG
  • BKK24880 (Δ[gene|C44F6723A2F1A627A0B9042871A07F5365D6121A|yqgO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATATCCCTCCTGCCAA, downstream forward: _UP4_TAAAATCCCGTGAAAAACGG