SubtiBank SubtiBank
hepS
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

hepS

heptaprenyl diphosphate synthase component I
locus
BSU_22760
pI
6.27
mw
28.97 kDa
protein length
251 aa Sequence Blast
gene length
756 bp Sequence Blast
function
menaquinone biosynthesis
product
heptaprenyl diphosphate synthase component I (together with [protein|3CAEA54E80A0B56EE120B881C8CDBE055AF6BDC1|HepT])
essential
no
ec
2.5.1.30
synonyms
gerCA,hepA

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.8|Biosynthesis of menaquinone]
  • Gene

    Coordinates
    2,383,615 → 2,384,370

    Phenotypes of a mutant

  • essential [Pubmed|12682299], non-essential according to [Pubmed|28189581]
  • The protein

    Catalyzed reaction/ biological activity

  • (2E,6E)-farnesyl diphosphate + 4 isopentenyl diphosphate --> all-trans-heptaprenyl diphosphate + 4 diphosphate (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|C45A5935559F0DAAD70F808725AF730BC18A2B0A|hepS]-[gene|DDD40AEBBCBD3C19661A72B85912E266DBF267B3|menH]-[gene|3CAEA54E80A0B56EE120B881C8CDBE055AF6BDC1|hepT]-[gene|B498ED03F19B7A73878D5C947C28C2A87CAB934D|ndk]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE22760 (Δ[gene|C45A5935559F0DAAD70F808725AF730BC18A2B0A|hepS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22760 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAATATCACCCTTGTCC, downstream forward: _UP4_TAAACCATTATGCAGGACTC
  • BKK22760 (Δ[gene|C45A5935559F0DAAD70F808725AF730BC18A2B0A|hepS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22760 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAATATCACCCTTGTCC, downstream forward: _UP4_TAAACCATTATGCAGGACTC
  • References

  • 23840410,28189581