SubtiBank SubtiBank
acoC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

acoC

acetoin dehydrogenase E2 component (dihydrolipoamide acetyltransferase)
locus
BSU_08080
pI
6.52
mw
42.73 kDa
protein length
398 aa Sequence Blast
gene length
1197 bp Sequence Blast
function
acetoin utilization
product
acetoin dehydrogenase E2 component (dihydrolipoamide acetyltransferase)
essential
no
ec
2.3.1.12
synonyms
yfjI

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.2|Utilization of acetoin]
  • Gene

    Coordinates
    881,049 → 882,245

    The protein

    Catalyzed reaction/ biological activity

  • (R)-N6-dihydrolipoyl-L-lysyl-[protein] + acetyl-CoA --> (R)-N6-(S8-acetyldihydrolipoyl)-L-lysyl-[protein] + CoA (according to UniProt)
  • Protein family

  • [SW|2-oxoacid dehydrogenase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|02BA02D10DFB06E51101D8CF76BCF5BED94D7CA2|OdhB], [protein|262C9FD20C7A70B6F1FEB57735FA800F38EAB25A|BkdB], [protein|2F40086E35FA32136B9A89C530A86D714FE9460C|PdhC]
  • [SW|Cofactors]

  • lipoic acid
  • Structure

  • [PDB|3DUF] (PDH from Geobacillus stearothermophilus, 33% identity) [pubmed|19081062]
  • [SW|Localization]

  • Membrane-proximal (Spotty) [Pubmed|16479537]
  • Expression and Regulation

    Operons

    genes
    [gene|B0A333BDFAE816B48B856A1DD91B73C41584A8E4|acoA]-[gene|5F953C3C91EB65A031D04A1D91F1CF501F8EFD09|acoB]-[gene|C4B6C3EE560C8BD353FEABB1A607C89C20DC8D34|acoC]-[gene|2ECF05AEE1549861EB3AE62139F0E9DEE0B0F632|acoL]
    description
    [pubmed|11274109]

    sigma factors

  • [protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL]: sigma factor, [PubMed|11274109], in [regulon|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|10666464], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|706864AAF36684AD5E46F30E9EB76315AB412700|AcoR]: activation, (interaction with [protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL]-containing [SW|RNA polymerase]) [ PubMed|11274109], in [regulon|706864AAF36684AD5E46F30E9EB76315AB412700|AcoR regulon]
  • [protein|7165CC59CDAF64AAE2D591936860304A53BE5DF6|Fnr]: indirect positive regulation, in [regulon|7165CC59CDAF64AAE2D591936860304A53BE5DF6|Fnr regulon]
  • regulation

  • induced by acetoin ([protein|706864AAF36684AD5E46F30E9EB76315AB412700|AcoR]) [http://www.ncbi.nlm.nih.gov/sites/entrez/11274109 PubMed]
  • expression of the operon is strongly induced during [SW|biofilm formation] [pubmed|31113899]
  • additional information

  • the mRNA is substantially stabilized upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|21815947]
  • view in new tab

    additional information

  • the mRNA is very stable (> 15 min) [pubmed|12884008]
  • Biological materials

    Mutant

  • MGNA-C282 (acoC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2280 NBRP B. subtilis, Japan]
  • BKE08080 (Δ[gene|C4B6C3EE560C8BD353FEABB1A607C89C20DC8D34|acoC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08080 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTTACCGCCATTTGTGTCC, downstream forward: _UP4_TAGGAAAAGCAGGTGAAAAC
  • BKK08080 (Δ[gene|C4B6C3EE560C8BD353FEABB1A607C89C20DC8D34|acoC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08080 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTTACCGCCATTTGTGTCC, downstream forward: _UP4_TAGGAAAAGCAGGTGAAAAC
  • labs

  • [SW|Michel Debarbouille], Pasteur Institute, Paris, France [http://www.pasteur.fr/ip/easysite/go/03b-00000m-0ob/recherche/departements-scientifiques/microbiologie/unites-et-groupes/unite-de-biologie-des-bacteries-pathogenes-a-gram-positif/les-membres-de-l-equipe Homepage]
  • References

    Reviews

  • 27074917
  • Original publications

  • 11274109,10368162,10666464,16479537,16428414,12884008,21815947,19081062,31066113