SubtiBank SubtiBank
cotQ

cotQ

outer spore coat protein
locus
BSU_34520
pI
6.10
mw
49.92 kDa
protein length
447 aa Sequence Blast
gene length
1344 bp Sequence Blast
function
protection of the spore
product
spore coat protein
essential
no
synonyms
yvdP

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.5|Class V]
  • Gene

    Coordinates
    3,542,943 → 3,544,286

    The protein

    Protein family

  • oxygen-dependent FAD-linked oxidoreductase family (with [protein|23F2385D14DDD5C400DC897E0F0FC814ACFC36B8|YitY] and [protein|11499CDC836A40E857B8F5AD746BA2C650DC916B|YgaK], according to UniProt)
  • Paralogous protein(s)

  • [protein|11499CDC836A40E857B8F5AD746BA2C650DC916B|YgaK]:
  • [SW|Domains]

  • [SW|FAD-binding PCMH-type domain] (aa 29-201) (according to UniProt)
  • [SW|Cofactors]

  • FAD (according to UniProt)
  • Structure

  • [PDB|3W8W] (EncM from Streptomyces maritimus, 32% identity) [pubmed|24162851]
  • [SW|Localization]

  • outer spore coat, localization depends on [protein|825AD8D4315A85CD384F9AF6AD894E38E57C88F7|CotE] [Pubmed|22171814]
  • Expression and Regulation

    Operons

    genes
    [gene|C4CC3772CA9FC46D90D2F15AE261106A0BC4453C|cotQ]
    description
    [Pubmed|12480901]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|12480901], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: activation, [Pubmed|15383836], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed late during sporulation ([protein|search|SigG], [protein|search|SigK], [protein|search|GerE]) [Pubmed|15383836,15699190,12480901]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B620 (yvdP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1619 NBRP B. subtilis, Japan]
  • BKE34520 (Δ[gene|C4CC3772CA9FC46D90D2F15AE261106A0BC4453C|cotQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATATTATTTCACTCCCA, downstream forward: _UP4_TAAAGTTTATTAAAGACAGA
  • BKK34520 (Δ[gene|C4CC3772CA9FC46D90D2F15AE261106A0BC4453C|cotQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATATTATTTCACTCCCA, downstream forward: _UP4_TAAAGTTTATTAAAGACAGA
  • References

  • 12562816,15699190,12480901,22171814,15383836,28870294,24162851