SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


spore germination protein, facilitates access of nutrient germinants to their cognate germinant receptors in spores’ inner membrane
7.41 kDa
protein length
gene length
222 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW|Additional germination proteins]
  • Gene

    1,150,206 → 1,150,427

    The protein

    Protein family

  • [SW|GerPA/GerPF family] (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: repression, in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed during sporulation in the mother cell ([protein|search|SigK]) [Pubmed|15699190,10715007]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|gerPA]' and '[protein|search|yisI]' [PubMed|20525796]
  • view in new tab

    Biological materials


  • BKE10720 (Δ[gene|C4DA51243A4249B2489133C8EF0F8A30B05F4C86|gerPA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACGAGCACATCCTTTGT, downstream forward: _UP4_AATGCGTAAAAGGAGTGAGG
  • BKK10720 (Δ[gene|C4DA51243A4249B2489133C8EF0F8A30B05F4C86|gerPA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACGAGCACATCCTTTGT, downstream forward: _UP4_AATGCGTAAAAGGAGTGAGG
  • References

  • 10715007,20525796