SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


ribosome-nascent chain sensor of membrane protein biogenesis
11.01 kDa
protein length
gene length
288 bp Sequence Blast
control of yidC2 translation
sensor of SpoIIIJ activity

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|Translation/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,483,586 → 2,483,873

    The protein

    Catalyzed reaction/ biological activity

  • acts as a kind of "leader peptide" that does or does not allow translation through a hairpin structure in the ''[gene|121A9543F5BC1CBE77D85A34099DE09F8AC63E9F|yidC2]'' mRNA [Pubmed|19779460]
  • [SW|Domains]

  • N-terminal transmembrane domain [Pubmed|22864117]
  • the C-terminal domain interacts with the ribosome and arrests the own translation elongation [Pubmed|22864117]
  • Structure

  • [PDB|3J9W] ([protein|C50AE06E8C959EB7176504C8E2BAD1A08E47C51A|MifM]-stalled [SW|ribosome] complex) [Pubmed|25903689]
  • [ EMD-6306] ([protein|C50AE06E8C959EB7176504C8E2BAD1A08E47C51A|MifM]-stalled [SW|ribosome] complex) [Pubmed|25903689]
  • [SW|Localization]

  • membrane [Pubmed|19779460]
  • Expression and Regulation



    regulatory mechanism

  • [protein|C50AE06E8C959EB7176504C8E2BAD1A08E47C51A|MifM]: attenuation, an mRNA hairpin of the yqjG transcript unfold upon translation arrest of [protein|C50AE06E8C959EB7176504C8E2BAD1A08E47C51A|MifM] at decreased [protein|D40C202E67A5319A91811DB11356F47A56C97DD2|YidC1] levels, in [regulon|C50AE06E8C959EB7176504C8E2BAD1A08E47C51A|MifM regulon]
  • regulation

  • repressed by large amounts of [SW|SpoIIIJ], induced by small amounts of [SW|SpoIIIJ] ([protein|search|MifM]) [Pubmed|19779460]
  • additional information

  • An [ncRNA|search|antisense RNA] is predicted for '[protein|search|mifM]' [PubMed|20525796]
  • view in new tab

    Biological materials


  • BKE23880 (Δ[gene|C50AE06E8C959EB7176504C8E2BAD1A08E47C51A|mifM]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACATCCATTCAATAGC, downstream forward: _UP4_TAAACCGCATTTATAAAAAG
  • BKK23880 (Δ[gene|C50AE06E8C959EB7176504C8E2BAD1A08E47C51A|mifM]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACATCCATTCAATAGC, downstream forward: _UP4_TAAACCGCATTTATAAAAAG
  • References

  • 19779460,21383133,20525796,22456704,22383849,22864117,25313395,25903689,29985442