SubtiBank SubtiBank
yvcN
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yvcN

unknown
locus
BSU_34730
pI
5.58
mw
28.68 kDa
protein length
254 aa Sequence Blast
gene length
765 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,568,527 → 3,569,291

    The protein

    Protein family

  • [SW|Acetyltransferase family] (according to UniProt)
  • Structure

  • [PDB|3LNB] (from ''B. anthracis'', 35% identity, 68% similarity)
  • Additional information

  • The gene is annotated in KEGG as an ortholog of EC 2.3.1.5 and is marked in Swiss-Prot as “uncharacterized acetyltransferase” (EC 2.3.1.-). No EC annotation is available in MetaCyc.No literature/ experimental evidence supporting the annotation is available. [Pubmed|19935659]
  • Expression and Regulation

    Operons

    genes
    [gene|0C40455EB53D25363FC3EB0E84502A76520F5F91|yvcI]-[gene|EB12C6B4F36B57BF0C59CE048CBAE18734C78D35|yvcJ]-[gene|7150BABA5086D5E2EB8102E4901A216F43576282|glmR]-[gene|1986DB3078FBA16D6ACCD70EEAC95C46564D0958|whiA]-[gene|A269774F2FDC94F93BA5F1360FFFE754B50383AD|crh]-[gene|C521BEE1EEEA7AD283A3C47C34301A8603CD9188|yvcN]
    description
    [Pubmed|9237995]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16272399], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • constitutive expression at both protein and RNA levels [Pubmed|24097947,22383849]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|yvcI]' and '[protein|search|trxB]' [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B638 (yvcN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1637 NBRP B. subtilis, Japan]
  • BKE34730 (Δ[gene|C521BEE1EEEA7AD283A3C47C34301A8603CD9188|yvcN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAGAAAGTCACTCATTTTTA, downstream forward: _UP4_TAACGTGAAAAGCTTGCAGG
  • BKK34730 (Δ[gene|C521BEE1EEEA7AD283A3C47C34301A8603CD9188|yvcN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAGAAAGTCACTCATTTTTA, downstream forward: _UP4_TAACGTGAAAAGCTTGCAGG
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • References

  • 9237995,16272399