SubtiBank SubtiBank
yrzE
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yrzE

unknown
locus
BSU_27690
pI
6.94
mw
16.18 kDa
protein length
150 aa Sequence Blast
gene length
453 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    2,831,915 → 2,832,367

    Expression and Regulation

    Operons

    genes
    [gene|C52461A2FE856C94E0D0701FB7412368404FC83B|yrzE]
    description
    [pubmed|22383849]
    view in new tab

    genes
    [gene|9633C40190B7D0EA264270FD44567C61A012AD15|spoVB]-[gene|C52461A2FE856C94E0D0701FB7412368404FC83B|yrzE]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [pubmed|1744050], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: repression, [pubmed|15383836], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE], [SW|SpoIIID]) [Pubmed|1744050,15383836]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B520 (yrzE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1519 NBRP B. subtilis, Japan]
  • BKE27690 (Δ[gene|C52461A2FE856C94E0D0701FB7412368404FC83B|yrzE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTGATGGCTCGTCTTT, downstream forward: _UP4_TAAAAAAGAGCGGGCTCACT
  • BKK27690 (Δ[gene|C52461A2FE856C94E0D0701FB7412368404FC83B|yrzE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTGATGGCTCGTCTTT, downstream forward: _UP4_TAAAAAAGAGCGGGCTCACT