SubtiBank SubtiBank
ycgJ

ycgJ

similar to predicted S-adenosylmethionine-dependent methyltransferase
locus
BSU_03160
pI
5.81
mw
25.61 kDa
protein length
253 aa Sequence Blast
gene length
762 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    340,613 → 341,374

    The protein

    Protein family

  • [SW|Methyltransferase superfamily] (according to UniProt)
  • [SW|Cofactors]

  • SAM (according to UniProt)
  • Structure

  • [PDB|2GLU]
  • [PDB|1XXL]
  • Expression and Regulation

    Operons

    genes
    [gene|C5382E3BDF55137EB86BBE7218A711B86B7A742A|ycgJ]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C051 (ycgJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2049 NBRP B. subtilis, Japan]
  • BKE03160 (Δ[gene|C5382E3BDF55137EB86BBE7218A711B86B7A742A|ycgJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03160 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGAACCAGCTCCTTCT, downstream forward: _UP4_TAAAAAAAGCCGTGCGCTGC
  • BKK03160 (Δ[gene|C5382E3BDF55137EB86BBE7218A711B86B7A742A|ycgJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03160 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGAACCAGCTCCTTCT, downstream forward: _UP4_TAAAAAAAGCCGTGCGCTGC
  • References

    Research papers

  • 28898812