SubtiBank SubtiBank
yusY
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yusY

similar to oligoendopeptidase, inactive pseudogene
locus
BSU_32970
pI
4.28
mw
10.00 kDa
protein length
gene length
291 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.10|Pseudogenes]
  • Gene

    Coordinates
    3,382,209 → 3,382,499

    Expression and Regulation

    Operons

    genes
    [gene|91C89960ABE800BB25CA48A97A5D32CC308D3D31|yusY/1]-[gene|C56194753AF3CA8068B1FE15445EA32FAA2B8A62|yusY]

    description

  • [Pubmed|22383849]
  • view in new tab

    Biological materials

    Mutant

  • BKE32970 (Δ[gene|C56194753AF3CA8068B1FE15445EA32FAA2B8A62|yusY]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCACAAAACCCCTTTC, downstream forward: _UP4_CAGGCCTCATGAATCGGCTT
  • BKK32970 (Δ[gene|C56194753AF3CA8068B1FE15445EA32FAA2B8A62|yusY]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCACAAAACCCCTTTC, downstream forward: _UP4_CAGGCCTCATGAATCGGCTT
  • References

  • 11741842