SubtiBank SubtiBank
refZ
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

refZ

regulator of [protein|search|FtsZ ]([SW|TetR family]), facilitates switch from medial to polar [protein|search|FtsZ ]ring placement during sporulation
locus
BSU_29630
pI
6.71
mw
24.24 kDa
protein length
207 aa Sequence Blast
gene length
624 bp Sequence Blast
function
relocalization of the [protein|search|FtsZ ]ring, placement of the sporulation septum
product
regulator of [protein|41872E2EF00C79918DD077F2EF78F37E24FEB110|FtsZ]
essential
no
synonyms
yttP

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.8|Cell division] → [category|SW 1.1.8.2|Other genes]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    3,032,417 → 3,033,040

    The protein

    Catalyzed reaction/ biological activity

  • facilitates switch from medial to polar [protein|41872E2EF00C79918DD077F2EF78F37E24FEB110|FtsZ] ring placement during [SW|sporulation] [Pubmed|22730127]
  • binds to specific DNA motifs (RBMs) that localize near the poles at the time of septation [pubmed|31160399]
  • Protein family

  • [SW|TetR family]
  • [SW|Domains]

  • TetR-like DNA-binding helix-turn-helix domain at the N-terminus [Pubmed|22730127]
  • [SW|HTH tetR-type domain] (aa 3-63) (according to UniProt)
  • Structure

  • [PDB|6MJ1]
  • [SW|Localization]

  • polar foci [Pubmed|22730127]
  • Expression and Regulation

    Operons

    genes
    [gene|C5F67C3ACB06A5029B4AE69A065BC55622372404|refZ]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12850135], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|14762014], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • regulation

  • expressed under conditions of phosphate limitation ([protein|search|PhoP]) [Pubmed|14762014]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A426 (yttP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/426 NBRP B. subtilis, Japan]
  • BKE29630 (Δ[gene|C5F67C3ACB06A5029B4AE69A065BC55622372404|refZ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACGGCTCACTCCTTCCT, downstream forward: _UP4_AACTAGCACCGTTCCAAAAA
  • BKK29630 (Δ[gene|C5F67C3ACB06A5029B4AE69A065BC55622372404|refZ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACGGCTCACTCCTTCCT, downstream forward: _UP4_AACTAGCACCGTTCCAAAAA
  • References

    Reviews

  • 24006471
  • Original publications

  • 14651647,14762014,12850135,22730127,22383849,26360512,30092000,31160399