SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


50.35 kDa
protein length
449 aa Sequence Blast
gene length
1350 bp Sequence Blast
maltose utilization

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of maltose]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    890,022 → 891,371

    The protein

    Catalyzed reaction/ biological activity

  • α-maltose 6'-phosphate + H2O --> D-glucose + D-glucose 6-phosphate (according to UniProt)
  • Protein family

  • [SW|Glycosyl hydrolase 4 family] (according to UniProt)
  • Structure

  • [PDB|1U8X]
  • [SW|Localization]

  • membrane associated [Pubmed|18763711]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11489864], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|AD72489DA260F07B97A213F1F0FBA7CED9471817|GlvR]: activation, [Pubmed|11489864], in [regulon|AD72489DA260F07B97A213F1F0FBA7CED9471817|GlvR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|11489864], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induction by maltose ([protein|search|GlvR]) [Pubmed|11489864]
  • view in new tab

    Biological materials


  • MGNA-C289 (glvA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE08180 (Δ[gene|C650160C9E5B5F8587CA9E80A57BCCE97D701037|malA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGACGACCTCCTTGAT, downstream forward: _UP4_TAAATGAAATTCCCCCATTT
  • BKK08180 (Δ[gene|C650160C9E5B5F8587CA9E80A57BCCE97D701037|malA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGACGACCTCCTTGAT, downstream forward: _UP4_TAAATGAAATTCCCCCATTT
  • References

  • 22900538,16707683,10627040,18763711,9765262,11489864,17676871,15341727,20618987