SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


50.35 kDa
protein length
449 aa Sequence Blast
gene length
1350 bp Sequence Blast
maltose utilization

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of maltose]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    890,022 → 891,371

    The protein

    Catalyzed reaction/ biological activity

  • α-maltose 6'-phosphate + H2O --> D-glucose + D-glucose 6-phosphate (according to UniProt)
  • Protein family

  • [SW|Glycosyl hydrolase 4 family] (according to UniProt)
  • Structure

  • [PDB|1U8X]
  • [SW|Localization]

  • membrane associated [Pubmed|18763711]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11489864], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|AD72489DA260F07B97A213F1F0FBA7CED9471817|GlvR]: activation, [Pubmed|11489864], in [regulon|AD72489DA260F07B97A213F1F0FBA7CED9471817|GlvR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|11489864], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induction by maltose ([protein|search|GlvR]) [Pubmed|11489864]
  • view in new tab

    Biological materials


  • MGNA-C289 (glvA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE08180 (Δ[gene|C650160C9E5B5F8587CA9E80A57BCCE97D701037|malA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGACGACCTCCTTGAT, downstream forward: _UP4_TAAATGAAATTCCCCCATTT
  • BKK08180 (Δ[gene|C650160C9E5B5F8587CA9E80A57BCCE97D701037|malA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGACGACCTCCTTGAT, downstream forward: _UP4_TAAATGAAATTCCCCCATTT
  • References

  • 22900538,16707683,10627040,18763711,9765262,11489864,17676871,15341727,20618987