SubtiBank SubtiBank
bstH
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

bstH

bacillithiol S-transferase
locus
BSU_10800
pI
5.96
mw
18.67 kDa
protein length
159 aa Sequence Blast
gene length
480 bp Sequence Blast
function
unknown
product
bacillithiol S-transferase
essential
no
synonyms
yizA

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,159,211 → 1,159,690

    The protein

    Protein family

  • [SW|S-transferase-like (STL) superfamily] [pubmed|29451913]
  • [SW|DinB family] (according to UniProt)
  • Structure

  • [PDB|2QE9]
  • Expression and Regulation

    Operons

    genes
    [gene|C662129AEA8FDF00166537285631FF07CC246CC2|bstH]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE10800 (Δ[gene|C662129AEA8FDF00166537285631FF07CC246CC2|bstH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTAAACTCACTCCAATAC, downstream forward: _UP4_TGAAGGAATGCGGGGGCAAT
  • BKK10800 (Δ[gene|C662129AEA8FDF00166537285631FF07CC246CC2|bstH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTAAACTCACTCCAATAC, downstream forward: _UP4_TGAAGGAATGCGGGGGCAAT
  • References

    Research papers

  • 29451913