SubtiBank SubtiBank
gntP
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

gntP

gluconate permease
locus
BSU_40070
pI
8.10
mw
46.49 kDa
protein length
448 aa Sequence Blast
gene length
1347 bp Sequence Blast
function
gluconate uptake
product
gluconate permease
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.3|Carbohydrate transporter]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.13|Utilization of gluconate]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    4,115,711 → 4,117,057

    The protein

    Protein family

  • GntP permease family (with [protein|C62164C159495FDE001F36AF5F6E35C10812ABE4|YojA], according to UniProt)
  • Paralogous protein(s)

  • [protein|C62164C159495FDE001F36AF5F6E35C10812ABE4|YojA]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|1C566E54F8EF1A17A365FC49DFDA452AC5D0CA64|gntR]-[gene|72404FA6ECD62AEA3EFDB934DFB8DA581875605C|gntK]-[gene|C6810A4ACD51EB8D14E5B30163348058196266A1|gntP]-[gene|7E7187AA2DC172018A63A7B9CE48124F30311639|gntZ]
    description
    [pubmed|10746760,3020045]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|3020045], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|1C566E54F8EF1A17A365FC49DFDA452AC5D0CA64|GntR]: repression, [Pubmed|3020045], in [regulon|1C566E54F8EF1A17A365FC49DFDA452AC5D0CA64|GntR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|10666464], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: activation, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • induced by gluconate ([protein|search|GntR]) [Pubmed|3020045]
  • view in new tab

    Biological materials

    Mutant

  • BKE40070 (Δ[gene|C6810A4ACD51EB8D14E5B30163348058196266A1|gntP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTAATGCCCTCCCCTT, downstream forward: _UP4_TGAAATTAAGAAGGAGCTGT
  • BKK40070 (Δ[gene|C6810A4ACD51EB8D14E5B30163348058196266A1|gntP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTAATGCCCTCCCCTT, downstream forward: _UP4_TGAAATTAAGAAGGAGCTGT
  • References

  • 3011959,8288545,3037520,2537826,3020045,10746760,8370661,1659648,220817675