SubtiBank SubtiBank
trpF
The papers of the month are back! Check them out! Link here

trpF

phosphoribosylanthranilate isomerase
locus
BSU22650
pI
8.37
mw
23.91 kDa
protein length
215 aa Sequence Blast
gene length
645 bp Sequence Blast
function
biosynthesis of tryptophan
product
phosphoribosylanthranilate isomerase
essential
no
ec
5.3.1.24
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.13|Biosynthesis/ acquisition of aromatic amino acids]
  • Gene

    Coordinates
    2,373,487 → 2,374,134

    The protein

    Catalyzed reaction/ biological activity

  • N-(5-phospho-beta-D-ribosyl)anthranilate = 1-(2-carboxyphenylamino)-1-deoxy-D-ribulose 5-phosphate (according to Swiss-Prot)
  • Protein family

  • TCR/tet family (according to Swiss-Prot)
  • Structure

  • [PDB|1DL3] (from Thermotoga maritima, 33% identity) [pubmed|10745009]
  • Expression and Regulation

    Operons

    genes
    [gene|48C33A96F3B446440D4D9A86AA07AA3BA244063D|trpE]-[gene|4CD2A930753175B7F533EA6B91478577CE80A29C|trpD]-[gene|0467447B10EE7C1FDF86022AB6FBDBABFD32A9E5|trpC]-[gene|C6872585F9BD3717A4F49E96F7684C4A5AD1760D|trpF]-[gene|AEB1F4E28C5B2AFC7FCF65721D4D1A70D6FC38EE|trpB]-[gene|155FE26C148F7022948DD7539533AB6876571862|trpA]
    description
    [Pubmed|21815947]

    regulatory mechanism

  • [protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB]: termination/antitermination, [pubmed|1551827], in [regulon|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB regulon]
  • regulation

  • not expressed if tryptophan is available ([protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB]) [Pubmed|1551827]
  • the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • the [SW|RNA switch] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    genes
    [gene|48C33A96F3B446440D4D9A86AA07AA3BA244063D|trpE]-[gene|4CD2A930753175B7F533EA6B91478577CE80A29C|trpD]-[gene|0467447B10EE7C1FDF86022AB6FBDBABFD32A9E5|trpC]-[gene|C6872585F9BD3717A4F49E96F7684C4A5AD1760D|trpF]-[gene|AEB1F4E28C5B2AFC7FCF65721D4D1A70D6FC38EE|trpB]-[gene|155FE26C148F7022948DD7539533AB6876571862|trpA]-[gene|4D7D62B4CDA350DCDC04E6934B5E23ECE4C57870|hisC]-[gene|DEB8358CE34F80560BE91F036659EF2C67A19623|tyrA]-[gene|CA00DFB480CBDC8AC31559958EF8E97E1E9BD4E1|aroE]
    description
    [Pubmed|21815947]

    regulatory mechanism

  • [protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB]: termination/antitermination, [pubmed|1551827], in [regulon|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB regulon]
  • regulation

  • not expressed if tryptophan is available ([protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB]) [Pubmed|1551827]
  • the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab

    Biological materials

    Mutant

  • BKE22650 (Δ[gene|C6872585F9BD3717A4F49E96F7684C4A5AD1760D|trpF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTTAATGCCGGTTTCTTCA, downstream forward: _UP4_CTTTTAGAAGAAAGGATGAA
  • BKK22650 (Δ[gene|C6872585F9BD3717A4F49E96F7684C4A5AD1760D|trpF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTTAATGCCGGTTTCTTCA, downstream forward: _UP4_CTTTTAGAAGAAAGGATGAA
  • References

    Reviews

  • 12966138
  • Original publications

  • 14976255,3924737,6436812,2422155,8419914,1551827,21815947,10745009