SubtiBank SubtiBank
trpF
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.

trpF

phosphoribosylanthranilate isomerase
locus
BSU22650
pI
8.37
mw
23.91 kDa
protein length
215 aa Sequence Blast
gene length
645 bp Sequence Blast
function
biosynthesis of tryptophan
product
phosphoribosylanthranilate isomerase
essential
no
ec
5.3.1.24
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.13|Biosynthesis/ acquisition of aromatic amino acids]
  • Gene

    Coordinates
    2,373,487 → 2,374,134

    The protein

    Catalyzed reaction/ biological activity

  • N-(5-phospho-beta-D-ribosyl)anthranilate = 1-(2-carboxyphenylamino)-1-deoxy-D-ribulose 5-phosphate (according to Swiss-Prot)
  • Protein family

  • TCR/tet family (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|48C33A96F3B446440D4D9A86AA07AA3BA244063D|trpE]-[gene|4CD2A930753175B7F533EA6B91478577CE80A29C|trpD]-[gene|0467447B10EE7C1FDF86022AB6FBDBABFD32A9E5|trpC]-[gene|C6872585F9BD3717A4F49E96F7684C4A5AD1760D|trpF]-[gene|AEB1F4E28C5B2AFC7FCF65721D4D1A70D6FC38EE|trpB]-[gene|155FE26C148F7022948DD7539533AB6876571862|trpA]
    description
    [Pubmed|21815947]

    regulatory mechanism

  • [protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB]: termination/antitermination, [pubmed|1551827], in [regulon|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB regulon]
  • regulation

  • not expressed if tryptophan is available ([protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB]) [Pubmed|1551827]
  • view in new tab

    genes
    [gene|48C33A96F3B446440D4D9A86AA07AA3BA244063D|trpE]-[gene|4CD2A930753175B7F533EA6B91478577CE80A29C|trpD]-[gene|0467447B10EE7C1FDF86022AB6FBDBABFD32A9E5|trpC]-[gene|C6872585F9BD3717A4F49E96F7684C4A5AD1760D|trpF]-[gene|AEB1F4E28C5B2AFC7FCF65721D4D1A70D6FC38EE|trpB]-[gene|155FE26C148F7022948DD7539533AB6876571862|trpA]-[gene|4D7D62B4CDA350DCDC04E6934B5E23ECE4C57870|hisC]-[gene|DEB8358CE34F80560BE91F036659EF2C67A19623|tyrA]-[gene|CA00DFB480CBDC8AC31559958EF8E97E1E9BD4E1|aroE]
    description
    [Pubmed|21815947]

    regulatory mechanism

  • [protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB]: termination/antitermination, [pubmed|1551827], in [regulon|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB regulon]
  • regulation

  • not expressed if tryptophan is available ([protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB]) [Pubmed|1551827]
  • view in new tab

    Biological materials

    Mutant

  • BKE22650 (Δ[gene|C6872585F9BD3717A4F49E96F7684C4A5AD1760D|trpF]::erm trpC2), available at [http://www.bgsc.org/getdetail.php?bgscid=BSU22650 BGSC], upstream reverse: _UP1_TTTTAATGCCGGTTTCTTCA, downstream forward: _UP4_CTTTTAGAAGAAAGGATGAA
  • BKK22650 (Δ[gene|C6872585F9BD3717A4F49E96F7684C4A5AD1760D|trpF]::kan trpC2), available at [http://www.bgsc.org/getdetail.php?bgscid=BSU22650 BGSC], upstream reverse: _UP1_TTTTAATGCCGGTTTCTTCA, downstream forward: _UP4_CTTTTAGAAGAAAGGATGAA
  • References

  • 14976255,3924737,6436812,2422155,8419914,1551827,21815947