SubtiBank SubtiBank
yvbV
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yvbV

putative cysteine and O-acetyl serine efflux permease
locus
BSU_34000
pI
10.34
mw
32.67 kDa
protein length
305 aa Sequence Blast
gene length
918 bp Sequence Blast
function
unknown
product
putative cysteine and O-acetyl serine efflux permease
essential
no
synonyms
cyeB

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.4|Putative amino acid transporter]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,488,952 → 3,489,869

    The protein

    Protein family

  • [SW|EamA transporter family] (according to UniProt)
  • [SW|Domains]

  • 2 [SW|EamA domain]s (aa 18-141, aa 161-287) (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|C691DD957367F10E6C947AE69BB926462391FFDA|yvbV]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A467 (yvbV::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/467 NBRP B. subtilis, Japan]
  • BKE34000 (Δ[gene|C691DD957367F10E6C947AE69BB926462391FFDA|yvbV]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTCATTCACTCCTTG, downstream forward: _UP4_TAATAAAAACCCTCTTGCCG
  • BKK34000 (Δ[gene|C691DD957367F10E6C947AE69BB926462391FFDA|yvbV]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTCATTCACTCCTTG, downstream forward: _UP4_TAATAAAAACCCTCTTGCCG