SubtiBank SubtiBank
yqeC
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yqeC

similar to 6-phosphogluconate dehydrogenase
locus
BSU_25730
pI
5.82
mw
32.62 kDa
protein length
297 aa Sequence Blast
gene length
894 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    2,650,487 → 2,651,380

    The protein

    Protein family

  • 6-phosphogluconate dehydrogenase family (with [protein|61B7C51EB7E74226890010B61D8E41C02189A453|GndA] and [protein|7E7187AA2DC172018A63A7B9CE48124F30311639|GntZ], according to UniProt)
  • Paralogous protein(s)

  • [protein|7E7187AA2DC172018A63A7B9CE48124F30311639|GntZ]
  • Structure

  • [PDB|4E21] (from Geobacter Metallireducens 37% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|C6CB4993032D8C2CC79A06C67925096F0AFE48CB|yqeC]
    description
    [pubmed|22383849]

    regulation

  • expressed during [SW|sporulation] [pubmed|22383849]
  • view in new tab

    Biological materials

    Mutant

  • BKE25730 (Δ[gene|C6CB4993032D8C2CC79A06C67925096F0AFE48CB|yqeC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCTGTTCCTCCTGATT, downstream forward: _UP4_AAGTAAGGGGGCCAACAAGC
  • BKK25730 (Δ[gene|C6CB4993032D8C2CC79A06C67925096F0AFE48CB|yqeC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCTGTTCCTCCTGATT, downstream forward: _UP4_AAGTAAGGGGGCCAACAAGC