SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


transcription activator of [gene|4E1FD02C6FE4103E3B4942BF5221C062CB8D0B9B|gabT]-[gene|A0BEB92D54799956A4ADE106A1388E5710141069|gabD], repressor of [gene|search|gabR ]([SW|MocR/ GabR family])
55.00 kDa
protein length
479 aa Sequence Blast
gene length
1440 bp Sequence Blast
regulation of gamma-amino butyric acid utilization
transcription regulator

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW|Utilization of gamma-amino butyric acid]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • Gene

    440,025 → 441,464

    The protein

    Catalyzed reaction/ biological activity

  • transcription activation of the [gene|4E1FD02C6FE4103E3B4942BF5221C062CB8D0B9B|gabT]-[gene|A0BEB92D54799956A4ADE106A1388E5710141069|gabD] operon in the presence of GABA and PLP, transcription repression of [gene|C7C36FAC0CE72226960FC7E8E016B8EC77AF1036|gabR] [Pubmed|15223311]
  • Protein family

  • [SW|MocR/ GabR family] [Pubmed|22020104]
  • [SW|class-I pyridoxal-phosphate-dependent aminotransferase family] (according to UniProt)
  • [SW|Domains]

  • N-terminal DNA-binding helix-turn-helix motif (corresponding to domains of the [SW|GntR family]) [Pubmed|24127574]
  • C-terminal domain is homologous to PLP-binding large domain of aminotransferases [Pubmed|24127574]
  • [SW|HTH gntR-type domain] (aa 14-82) (according to UniProt)
  • [SW|Cofactors]

  • gamma-aminobutyric acid, PLP [Pubmed|31848410,24127574]
  • Effectors of protein activity

  • activation of ''[gene|4E1FD02C6FE4103E3B4942BF5221C062CB8D0B9B|gabT]-[gene|A0BEB92D54799956A4ADE106A1388E5710141069|gabD]'' expression is triggered by gamma-amino butyrate and pyridoxalphosphate [Pubmed|15223311]
  • in the absence of GABA, GabR represses [gene|4E1FD02C6FE4103E3B4942BF5221C062CB8D0B9B|gabT]-[gene|A0BEB92D54799956A4ADE106A1388E5710141069|gabD] expression, whereas binding of GABA to GabR results in a conformational change resulting in activation of transcription [pubmed|32147931]
  • Structure

  • [PDB|4MGR] (the apo-protein) [Pubmed|24127574]
  • [PDB|4N0B] (the complex with PLP) [Pubmed|24127574]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12123465], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|C7C36FAC0CE72226960FC7E8E016B8EC77AF1036|GabR]: negative autoregulation, [Pubmed|12123465], in [regulon|C7C36FAC0CE72226960FC7E8E016B8EC77AF1036|GabR regulon]
  • view in new tab

    Biological materials


  • MGNA-C014 (ycnF::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE03890 (Δ[gene|C7C36FAC0CE72226960FC7E8E016B8EC77AF1036|gabR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTGTAGTTTCTCCTTC, downstream forward: _UP4_AAAATCCCCGTTACAGGGGA
  • BKK03890 (Δ[gene|C7C36FAC0CE72226960FC7E8E016B8EC77AF1036|gabR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTGTAGTTTCTCCTTC, downstream forward: _UP4_AAAATCCCCGTTACAGGGGA
  • labs

  • [SW|Linc Sonenshein], Tufts University, Boston, MA, USA [ Homepage]
  • References

  • 11756427,15223311,12123465,24127574,22020104,25388514,25911692,27640111,26681693,28348215,28412355,29253008,31848410,32147931,32413777