SubtiBank SubtiBank
yhcU

yhcU

unknown
locus
BSU_09220
pI
9.26
mw
15.11 kDa
protein length
131 aa Sequence Blast
gene length
396 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    996,643 → 997,038

    Biological materials

    Mutant

  • MGNA-A680 (yhcU::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/680 NBRP B. subtilis, Japan]
  • BKE09220 (Δ[gene|C7D8F35444E0FB83B931EAF56E62E9E5014F0501|yhcU]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09220 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGAATATCCTAAGTCTT, downstream forward: _UP4_TAATCATGCGGCAAGGGCTT
  • BKK09220 (Δ[gene|C7D8F35444E0FB83B931EAF56E62E9E5014F0501|yhcU]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09220 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGAATATCCTAAGTCTT, downstream forward: _UP4_TAATCATGCGGCAAGGGCTT