SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


1,2,-dihydroxy-3-keto-5-methylthiopentene dioxygenase
20.68 kDa
protein length
178 aa Sequence Blast
gene length
537 bp Sequence Blast
methionine salvage
1,2,-dihydroxy-3-keto-5-methylthiopentene dioxygenase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of methionine/ S-adenosylmethionine]
  • Gene

    1,429,584 → 1,430,120

    The protein

    Catalyzed reaction/ biological activity

  • 1,2-dihydroxy-5-(methylsulfanyl)pent-1-en-3-one + O2 --> 3-(methylsulfanyl)propanoate + CO + formate + 2 H+ (according to UniProt)
  • 1,2-dihydroxy-5-(methylsulfanyl)pent-1-en-3-one + O2 --> 4-methylsulfanyl-2-oxobutanoate + formate + 2 H+ (according to UniProt)
  • Protein family

  • acireductone dioxygenase (ARD) family (single member, according to UniProt)
  • Structure

  • [PDB|4QGL] (from B. anthracis, 71% identity)
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12022921], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|S-box|S-box]: termination, the [SW|S-box] [SW|riboswitch] binds S-adenosylmethionine resulting in termination [Pubmed|10094622], in [regulon|S-box|S-box]
  • regulation

  • induced by methionine starvation ([SW|S-box]) [Pubmed|10094622]
  • view in new tab

    Biological materials


  • MGNA-A786 (ykrZ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE13620 (Δ[gene|C7D9E701B2CA2C9E85D69CAD6E0A45BE590BAED9|mtnD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCAATTCCTCCTTTTA, downstream forward: _UP4_TAAGCGTGAGATAGCCCCGT
  • BKK13620 (Δ[gene|C7D9E701B2CA2C9E85D69CAD6E0A45BE590BAED9|mtnD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCAATTCCTCCTTTTA, downstream forward: _UP4_TAAGCGTGAGATAGCCCCGT
  • References

  • 12022921,11914366,12107147,15102328,12787499,18039762,15378759