SubtiBank SubtiBank
ylbE
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ylbE

unknown
locus
BSU_14980
pI
10.12
mw
9.73 kDa
protein length
gene length
240 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    1,568,065 → 1,568,304

    Expression and Regulation

    Operons

    genes
    [gene|ECD40F139D57B159A54E660ABD0D92629490AE8D|ylbD]-[gene|C7FDE0BE621C48E2F8D7B00532403CA7D8B44660|ylbE]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190,15383836], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: activation, [Pubmed|15383836], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|search|SigK], [protein|search|GerE]) [Pubmed|15699190,15383836]
  • view in new tab

    Biological materials

    Mutant

  • BKE14980 (Δ[gene|C7FDE0BE621C48E2F8D7B00532403CA7D8B44660|ylbE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14980 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTGCGCATATGAGCTCCCC, downstream forward: _UP4_TAAAAGGCCCCGAAGAAGGG
  • BKK14980 (Δ[gene|C7FDE0BE621C48E2F8D7B00532403CA7D8B44660|ylbE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14980 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTGCGCATATGAGCTCCCC, downstream forward: _UP4_TAAAAGGCCCCGAAGAAGGG
  • References

  • 15699190,15383836,22383849