SubtiBank SubtiBank
ybcL
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ybcL

similar to chloramphenicol resistance protein
locus
BSU_01890
pI
9.86
mw
41.25 kDa
protein length
390 aa Sequence Blast
gene length
1173 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.12|Other transporters]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.4|Prophage 1]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    211,859 → 213,031

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|C8070C5525BB0763161EDC2127757BAE6C937823|ybcL]
    description
    [http://dbtbs.hgc.jp/COG/prom/ybcL.html DBTBS]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C510 (ybcL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2508 NBRP B. subtilis, Japan]
  • BKE01890 (Δ[gene|C8070C5525BB0763161EDC2127757BAE6C937823|ybcL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAACATTCACTCCTTA, downstream forward: _UP4_TAATTTCGAAAGTTCTAACA
  • BKK01890 (Δ[gene|C8070C5525BB0763161EDC2127757BAE6C937823|ybcL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAACATTCACTCCTTA, downstream forward: _UP4_TAATTTCGAAAGTTCTAACA