SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


two-component sensor kinase, regulation of phosphate metabolism
64.95 kDa
protein length
579 aa Sequence Blast
gene length
1740 bp Sequence Blast
regulation of phosphate metabolism
two-component sensor kinase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.3|Phosphate metabolism]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein kinases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Control of two-component response regulators] → [category|SW|Two-component sensor kinase]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    2,976,068 → 2,977,807

    The protein

    Catalyzed reaction/ biological activity

  • autophosphorylation, phosphorylation of [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]
  • ATP + protein L-histidine --> ADP + protein N-phospho-L-histidine (according to UniProt)
  • Paralogous protein(s)

  • [protein|E88978809272FAC2520DB4ABCA0554F8028F3451|WalK], [protein|EA6790EF30D3DDB9670FE52DFD2C5083AB6A48E1|ResE]
  • [SW|Domains]

  • two transmembrane segments
  • [SW|PAS domain], for binding of an intermediate of wall teichoic acid biosynthesis (lipid V composed of poly(glycerol phosphate)) [Pubmed|25315493]
  • C-terminal histidine phosphotransferase domain
  • Modification

  • autophosphorylation on a His residue in response to the the availability of an intermediate of wall teichoic acid bioynthesis, autophosphorylation is prevented by binding of this intermediate to the intracellular [SW|PAS domain] of [protein|C81F68521F17861D50926D7D8757DC1D2340BC0D|PhoR] [Pubmed|25315493]
  • Effectors of protein activity

  • activity is inhibited by binding of an intermediate of wall teichoic acid biosynthesis (lipid V composed of poly(glycerol phosphate) to the intracellular [SW|PAS domain] of [protein|C81F68521F17861D50926D7D8757DC1D2340BC0D|PhoR] [Pubmed|25315493]
  • the kinase activity is activated by an intermediate in the WTA biosynthetic pathway (product of [protein|72A89412C53703F96F835D26307263F5D1A4AB4E|TagA] or [protein|911A4D957A6C0DFC636A152395119DBFC777DDA2|TagB]) [pubmed|29644746]
  • Structure

  • [PDB|3CWF] (extracellular domain) [Pubmed|20008068]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16452408], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15205429], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,15205429], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|16452408,12850135], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC]: repression, [Pubmed|20382764], in [regulon|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC regulon]
  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, due to [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]~P binding to the 3’end of the [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]-[protein|C81F68521F17861D50926D7D8757DC1D2340BC0D|PhoR] operon [Pubmed|25666134,15205429,14762014], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • regulation

  • carbon catabolite repression ([protein|search|CcpA]) [Pubmed|16452408,12850135]
  • view in new tab

    Biological materials


  • 1A966 ( ''phoR''::''tet''), [Pubmed|14973033], available at [ BGSC]
  • BKE29100 (Δ[gene|C81F68521F17861D50926D7D8757DC1D2340BC0D|phoR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TACAGAAAAAAGGCGCACAC, downstream forward: _UP4_TAATGTTTACAAAGGTTTAA
  • BKK29100 (Δ[gene|C81F68521F17861D50926D7D8757DC1D2340BC0D|phoR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TACAGAAAAAAGGCGCACAC, downstream forward: _UP4_TAATGTTTACAAAGGTTTAA
  • labs

  • [SW|Marion Hulett], University of Illinois at Chicago, USA [ Homepage]
  • References


  • 10094672,25355628,30459743
  • Original publications

  • 20008068,10433720,15205429,9084179,17085571,9987123,10913081,16452408,20167622,15205429,14762014,20382764,25315493,29644746